Marker: D18Got8 |
Symbol: |
D18Got8 |
Previously known as: |
OT83.03; oxsts1459;
|
RGD ID: |
45589 |
Expected Size: |
137 (bp) |
Position |
Rat Assembly | Chr | Position (strand) | Source | JBrowse |
---|
mRatBN7.2 | 18 | 6,953,362 - 6,953,458 (+) | MAPPER | mRatBN7.2 | mRatBN7.2 | 18 | 6,953,362 - 6,953,499 (+) | MAPPER | mRatBN7.2 | Rnor_6.0 | 18 | 7,231,841 - 7,231,936 | NCBI | Rnor6.0 | Rnor_6.0 | 18 | 7,231,841 - 7,231,977 | NCBI | Rnor6.0 | Rnor_5.0 | 18 | 7,173,433 - 7,173,569 | UniSTS | Rnor5.0 | Rnor_5.0 | 18 | 7,173,433 - 7,173,528 | UniSTS | Rnor5.0 | RGSC_v3.4 | 18 | 7,107,187 - 7,107,282 | UniSTS | RGSC3.4 | RGSC_v3.4 | 18 | 7,107,187 - 7,107,323 | UniSTS | RGSC3.4 | RGSC_v3.4 | 18 | 7,107,186 - 7,107,323 | RGD | RGSC3.4 | RGSC_v3.4 | 18 | 7,107,186 - 7,107,282 | RGD | RGSC3.4 | RGSC_v3.1 | 18 | 7,107,187 - 7,107,323 | RGD | | Celera | 18 | 6,974,260 - 6,974,355 | UniSTS | | Celera | 18 | 6,974,260 - 6,974,396 | UniSTS | | RH 3.4 Map | 18 | 65.61 | RGD | | RH 3.4 Map | 18 | 65.61 | UniSTS | | RH 2.0 Map | 18 | 797.6 | RGD | |
|
Annotation
References - curated
| |
1. |
Data downloaded from Wellcome Trust, University of Oxford
|
2. |
Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
|
3. |
RGD automated pipelines
|
4. |
RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
|
5. |
Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
|
Strains and Sequence
Sequence
|
Forward Primer |
ACACACGAAGAACACACACACA |
Reverse Primer |
AATGACAGAAACTGGCACCTG |
|
Region
QTLs in Region (mRatBN7.2)
8552968 | Pigfal19 | Plasma insulin-like growth factor 1 level QTL 19 | 11.4 | | blood insulin-like growth factor amount (VT:0010479) | plasma insulin-like growth factor 1 level (CMO:0001299) | 18 | 1 | 25758124 | Rat | 9590248 | Scort10 | Serum corticosterone level QTL 10 | 19.71 | 0.001 | blood corticosterone amount (VT:0005345) | plasma corticosterone level (CMO:0001173) | 18 | 1 | 25758124 | Rat | 2312598 | Bp340 | Blood pressure QTL 340 | | 0.05 | arterial blood pressure trait (VT:2000000) | systolic blood pressure (CMO:0000004) | 18 | 1 | 30558703 | Rat | 2300180 | Bmd67 | Bone mineral density QTL 67 | 4.8 | 0.0001 | femur mineral mass (VT:0010011) | bone mineral density (CMO:0001226) | 18 | 1 | 34291613 | Rat | 2293661 | Bss50 | Bone structure and strength QTL 50 | 4.64 | 0.0003 | lumbar vertebra size trait (VT:0010518) | lumbar vertebra trabecular cross-sectional area (CMO:0001692) | 18 | 1 | 34291613 | Rat | 61388 | Bp2 | Blood pressure QTL 2 | 3.23 | | arterial blood pressure trait (VT:2000000) | diastolic blood pressure (CMO:0000005) | 18 | 1 | 35374722 | Rat | 9589153 | Insul31 | Insulin level QTL 31 | 7.15 | 0.05 | blood insulin amount (VT:0001560) | plasma insulin level (CMO:0000342) | 18 | 1 | 42547119 | Rat | 1641910 | Colcr3 | Colorectal carcinoma resistance QTL 3 | 5.02 | 0.000007 | intestine integrity trait (VT:0010554) | poorly differentiated malignant colorectal tumor surface area measurement (CMO:0002078) | 18 | 2249477 | 22066430 | Rat | 1641910 | Colcr3 | Colorectal carcinoma resistance QTL 3 | 5.02 | 0.000007 | intestine integrity trait (VT:0010554) | poorly differentiated malignant colorectal tumor number (CMO:0002076) | 18 | 2249477 | 22066430 | Rat | 2299160 | Iddm35 | Insulin dependent diabetes mellitus QTL 35 | 2.79 | | blood glucose amount (VT:0000188) | age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140) | 18 | 4207941 | 60377792 | Rat | 2312568 | Glom21 | Glomerulus QTL 21 | 2 | 0.005 | kidney glomerulus morphology trait (VT:0005325) | index of glomerular damage (CMO:0001135) | 18 | 5185858 | 40503530 | Rat | 11565454 | Kidm59 | Kidney mass QTL 59 | | 0.001 | kidney mass (VT:0002707) | both kidneys wet weight to body weight ratio (CMO:0000340) | 18 | 6791251 | 12205285 | Rat | 12904714 | Cm131 | Cardiac mass QTL 131 | | 0.002 | heart left ventricle mass (VT:0007031) | heart left ventricle weight to body weight ratio (CMO:0000530) | 18 | 6791251 | 12205285 | Rat | 12904715 | Cm132 | Cardiac mass QTL 132 | | 0.001 | heart right ventricle mass (VT:0007033) | heart right ventricle weight to body weight ratio (CMO:0000914) | 18 | 6791251 | 12205285 | Rat | 12904716 | Am21 | Aortic mass QTL 21 | | 0.005 | aorta mass (VT:0002845) | aorta weight to aorta length to body weight ratio (CMO:0002722) | 18 | 6791251 | 12205285 | Rat | 2301409 | Cm70 | Cardiac mass QTL 70 | | 0.001 | heart mass (VT:0007028) | heart weight to body weight ratio (CMO:0000074) | 18 | 6791251 | 12205285 | Rat | |
Additional Information
External Database Links
Database |
Acc Id |
Source(s) |
UniSTS |
114551 |
UniSTS |
|
|