D17Got37 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D17Got37

Symbol: D17Got37
Previously known as: OT38.48; oxsts1335; 
RGD ID: 45457
Expected Size: 111 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21729,261,312 - 29,261,423 (+)MAPPERmRatBN7.2
mRatBN7.23106,257,772 - 106,257,850 (+)MAPPERmRatBN7.2
Rnor_6.01729,952,357 - 29,952,467NCBIRnor6.0
Rnor_6.03111,075,642 - 111,075,719NCBIRnor6.0
Rnor_5.01731,852,041 - 31,852,151UniSTSRnor5.0
Rnor_5.03117,626,286 - 117,626,363UniSTSRnor5.0
RGSC_v3.43105,784,066 - 105,784,143UniSTSRGSC3.4
RGSC_v3.41735,575,293 - 35,575,404RGDRGSC3.4
RGSC_v3.41735,575,294 - 35,575,404UniSTSRGSC3.4
RGSC_v3.11735,578,135 - 35,578,245RGD
Celera1728,855,552 - 28,855,662UniSTS
Celera3105,170,997 - 105,171,074UniSTS
RH 3.4 Map17354.6RGD
RH 3.4 Map17354.6UniSTS
RH 2.0 Map17255.8RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer CTCTGGCTTCCACAGGCA
Reverse Primer AGAGAGAGGAGAGAGAGCATGTG
 

Region

Nucleotide Sequences
GenBank Nucleotide AU026776 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
10401807Kidm52Kidney mass QTL 52kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)17131701463Rat
70184BpQTLcluster14Blood pressure QTL cluster 143.38arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)17131990913Rat
631207Niddm41Non-insulin dependent diabetes mellitus QTL 41blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)17137830672Rat
1354658Spl8Serum phospholipid level QTL 83.8blood VLDL phospholipid amount (VT:0010507)blood very low density lipoprotein phospholipid level (CMO:0001571)17160781592Rat
1354581Bp247Blood pressure QTL 2474.5arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)17169599340Rat
1354662Rf49Renal function QTL 492.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)17169599340Rat
1300123Bp194Blood pressure QTL 1942.82arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)17211514934551001Rat
1354613Kidm14Kidney mass QTL 146.2kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)17429913035837242Rat
1354596Bw32Body weight QTL 324.5body mass (VT:0001259)body weight (CMO:0000012)17429913060781592Rat
1354630Cm34Cardiac mass QTL 348.7heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)17429913069599340Rat
1354638Insul1Insulin level QTL 14.8blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)17429913069599340Rat
1354651Lmblg2Limb length QTL 26tibia length (VT:0004357)tibia length (CMO:0000450)17429913069599340Rat
2303627Vencon8Ventilatory control QTL 80.001respiration trait (VT:0001943)tidal volume (CMO:0000222)17452803849528038Rat
10054088Scort28Serum corticosterone level QTL 282.040.0102blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)17452803849528038Rat
2303561Bw91Body weight QTL 912body mass (VT:0001259)body weight (CMO:0000012)17886846253868462Rat
2300002Iddm36Insulin dependent diabetes mellitus QTL 361.98blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)17999128640540197Rat
1331765Hrtrt15Heart rate QTL 154.094heart pumping trait (VT:2000009)heart rate (CMO:0000002)171533061355836425Rat
1354640Scl32Serum cholesterol level QTL 325.4blood HDL cholesterol amount (VT:0000184)blood high density lipoprotein cholesterol level (CMO:0000052)171578159260781592Rat
1354659Scl68Serum cholesterol level QTL 683.9blood VLDL cholesterol amount (VT:0005144)blood very low density lipoprotein cholesterol level (CMO:0000648)171578159260781592Rat
7394837Memor18Memory QTL 18exploratory behavior trait (VT:0010471)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)171864018263640182Rat
1354628Stl13Serum triglyceride level QTL 133.8blood triglyceride amount (VT:0002644)blood triglyceride level (CMO:0000118)172129303960781592Rat
70157Niddm32Non-insulin dependent diabetes mellitus QTL 324.34blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)172245492450909196Rat
61394Bp8Blood pressure QTL 82.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)172308056759555013Rat
7488966Bp370Blood pressure QTL 3700.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172365318457246843Rat
12903978Cm118Cardiac mass QTL 1180.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)172365318468653184Rat
12903979Cm119Cardiac mass QTL 1190.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)172365318468653184Rat
12903980Cm120Cardiac mass QTL 1200.002heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)172365318468653184Rat
12903981Am17Aortic mass QTL 170.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)172365318468653184Rat
1559055Bp278Blood pressure QTL 2780.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172365318468653184Rat
12903982Kidm70Kidney mass QTL 700.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)172365318470974005Rat
1354619Bp242Blood pressure QTL 2426.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)172459934069599340Rat
4889891Eae32Experimental allergic encephalomyelitis QTL 324.80.0002nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)172702794936146731Rat
1581512Cm55Cardiac mass QTL 552.80.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)172702794956836890Rat
4889955Bss93Bone structure and strength QTL 934.4tibia size trait (VT:0100001)tibia cortical bone volume to tibia total bone volume ratio (CMO:0001727)172702794960463643Rat
2302377Scl61Serum cholesterol level QTL 614.36blood HDL cholesterol amount (VT:0000184)serum high density lipoprotein cholesterol level (CMO:0000361)172738994653481766Rat
8552928Pigfal9Plasma insulin-like growth factor 1 level QTL 99blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)172840914773409147Rat
9590107Sffal7Serum free fatty acids level QTL 74.810.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)172840914773409147Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)329463235118376539Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)331172320163586636Rat
1358362Srcrt2Stress Responsive Cort QTL 22.78blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)338192233133483320Rat
2301970Bw81Body weight QTL 815.19body mass (VT:0001259)body weight (CMO:0000012)341874578155617519Rat
2301971Cm71Cardiac mass QTL 714.63heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)341874578155617519Rat
1581503Cm58Cardiac mass QTL 582.70.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)343827364121056321Rat
1559282Emca5Estrogen-induced mammary cancer QTL 53.9mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)343827364169034231Rat
2292591Esta4Estrogen-induced thymic atrophy QTL 4thymus mass (VT:0004954)thymus wet weight (CMO:0000855)347233211147415807Rat
1358186Ept2Estrogen-induced pituitary tumorigenesis QTL 28.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)347233430110362260Rat
2292613Ept16Estrogen-induced pituitary tumorigenesis QTL 168.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)347233430110362260Rat
631665Bw8Body weight QTL 85.5body mass (VT:0001259)body weight (CMO:0000012)350437042119183768Rat
724523Tsu1Thymus enlargement suppressive QTL 13.84thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)350437504115638231Rat
1582218Bw74Body weight QTL 743.90.0021body mass (VT:0001259)body weight (CMO:0000012)353184593115665732Rat
1582238Bw68Body weight QTL 683.20.0064body mass (VT:0001259)body weight (CMO:0000012)353184593115665732Rat
1582239Epfw1Epididymal fat weight QTL 14.50.0006epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)353184593115665732Rat
1581568Rf53Renal function QTL 53urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)356395968161299569Rat
8662816Vetf4Vascular elastic tissue fragility QTL 44renal artery integrity trait (VT:0010642)number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563)359242096157323038Rat
1300111Rf12Renal function QTL 123.78renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)361017749121056321Rat
1582210Bw71Body weight QTL 713.30.0012body mass (VT:0001259)body weight (CMO:0000012)364655305115665732Rat
1582221Kidm30Kidney mass QTL 303.50.0008kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)364655305115665732Rat
12879848Bw181Body weght QTL 1810.015body mass (VT:0001259)body weight (CMO:0000012)370348525121056321Rat
2301414Kidm37Kidney mass QTL 370.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)370653097121056321Rat
1600376Arunc5Aerobic running capacity QTL 50.21exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)373376539118376539Rat
1581546Pur13Proteinuria QTL 132.930.0335urine total protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)378196190146592722Rat
2302273Gluco35Glucose level QTL 355.30.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)380800231114297550Rat
631649Bp123Blood pressure QTL 1233.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)389772419134772419Rat
8694437Bw167Body weight QTL 16722.460.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)391797474136797474Rat
631841Niddm39Non-insulin dependent diabetes mellitus QTL 393.36blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)394856903159898684Rat
724532Cm17Cardiac mass QTL 172heart mass (VT:0007028)calculated heart weight (CMO:0000073)395735366140735366Rat
1582219Bw63Body weight QTL 633.80.001body mass (VT:0001259)body weight (CMO:0000012)396127817115665732Rat
1354611Despr2Despair related QTL 23.030.0028locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)397084464142084464Rat
2293087Iddm27Insulin dependent diabetes mellitus QTL 272.68blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)397551417147415807Rat
2312659Slep7Serum leptin concentration QTL 70.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)398535255168026850Rat
2312670Bw94Body weight QTL 940.01inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)398535255168026850Rat
2312673Scl63Serum cholesterol level QTL 630.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)398535255168026850Rat
2302373Gluco39Glucose level QTL 395.01blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)398535386161695835Rat
1582216Bw65Body weight QTL 656.3body mass (VT:0001259)body weight (CMO:0000012)3102200529115665732Rat


Additional Information

Database Acc Id Source(s)
UniSTS 113948 UniSTS