D16Wox7 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D16Wox7

Symbol: D16Wox7
Previously known as: RCA21.10; oxsts5607; 
RGD ID: 45369
Expected Size: 109 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21659,492,401 - 59,492,508 (+)MAPPERmRatBN7.2
Rnor_6.01663,210,195 - 63,210,301NCBIRnor6.0
Rnor_5.01662,873,068 - 62,873,174UniSTSRnor5.0
RGSC_v3.41663,306,108 - 63,306,215RGDRGSC3.4
RGSC_v3.41663,306,109 - 63,306,215UniSTSRGSC3.4
RGSC_v3.11663,306,183 - 63,306,290RGD
Celera1657,523,491 - 57,523,603UniSTS
RH 2.0 Map16669.4RGD
Cytogenetic Map16 RGD
Is Marker For: Strains:   DA.WOKW-(D16Rat88-D16Wox7)/K  
QTLs:   Bw95   Slep9   Insul16   Stl23  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines
3. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
4. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
5. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer AGTTCCAAGTGGGAAGTGCT
Reverse Primer CTTTTCAATCCTGACAGGCA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
621341Nrg1neuregulin 1165925065860304519Rat

Nucleotide Sequences
GenBank Nucleotide AJ231007 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
70215Niddm29Non-insulin dependent diabetes mellitus QTL 293.54blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)161900443575226532Rat
2302057Pia29Pristane induced arthritis QTL 293.60.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)162173597566735975Rat
8694453Bw172Body weight QTL 1728.330.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)162432551369325513Rat
6903294Stl30Serum triglyceride level QTL 302.60.0013blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)162515279370152793Rat
1298529Arunc1Aerobic running capacity QTL 14exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)163195152060148445Rat
1578768Stresp22Stress response QTL 222.8thymus mass (VT:0004954)thymus wet weight (CMO:0000855)163528887080288870Rat
2293690Bss45Bone structure and strength QTL 455.130.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)163775215682752156Rat
2300163Bmd64Bone mineral density QTL 645.30.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)163775215682752156Rat
7205510Activ5Activity QTL 53.780.00028locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)164239634584729064Rat
8694429Bw164Body weight QTL 16450.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)165272646484729064Rat
8694364Abfw7Abdominal fat weight QTL 712.220.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)165272646484729064Rat
7411648Foco22Food consumption QTL 22150.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)165272646484729064Rat
631525Pia14Pristane induced arthritis QTL 144.4joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)165571108783402471Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100303631 UniSTS
  100303633 UniSTS
  100303635 UniSTS
  100303637 UniSTS
UniSTS 118058 UniSTS