D13Got25 Marker Search Result - Rat Genome Database

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

General

Marker: D13Got25

Symbol:

D13Got25

Also known as:

OT06.09; oxsts957;

RGD ID:

45047

Expected Size:

135 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
Rnor_6.0	13	49,223,595 - 49,223,727	NCBI	Rnor6.0
Rnor_5.0	13	54,298,995 - 54,299,127	UniSTS	Rnor5.0
RGSC_v3.4	13	45,338,199 - 45,338,332	RGD	RGSC3.4
RGSC_v3.4	13	45,338,200 - 45,338,332	UniSTS	RGSC3.4
RGSC_v3.1	13	45,352,242 - 45,352,375	RGD
Celera	13	44,220,127 - 44,220,259	UniSTS
RH 2.0 Map	13	364.0	RGD
Cytogenetic Map	13	q13	UniSTS

Is Marker For:

Genes: Dstyk

Annotation

References - curated


1.	Data downloaded from Wellcome Trust, University of Oxford
2.	RGD automated pipelines
3.	RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
4.	Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence


Forward Primer	CATTCTGGCTTCTGCACATG
Reverse Primer	TGTAGGGTGCCAGAACTAAACC

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
735051	Dstyk	dual serine/threonine and tyrosine protein kinase	13	49195325	49243327	Rat

Nucleotide Sequences


GenBank Nucleotide	AC105650	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AU028810	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	DH550785	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (Rnor_6.0)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1354666	Bp244	Blood pressure QTL 244	4.9		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	1	107975663	Rat
1354666	Bp244	Blood pressure QTL 244	4.9		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	1	107975663	Rat
1354666	Bp244	Blood pressure QTL 244	4.9		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	13	1	107975663	Rat
61339	Bp24	Blood pressure QTL 24		0.05	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	9016742	50513953	Rat
1581554	Pur11	Proteinuria QTL 11			urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	13	9016906	82995569	Rat
1581573	Uae36	Urinary albumin excretion QTL 36			urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	13	9016906	82995569	Rat
1581570	Eae17	Experimental allergic encephalomyelitis QTL 17	4.1		nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)	13	12193394	108478121	Rat
9589141	Insul28	Insulin level QTL 28	10.82	0.001	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	13	14096330	59096330	Rat
7411662	Foco29	Food consumption QTL 29	20.8	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	13	14096330	59096330	Rat
1300163	Cardf1	Cardiac cell morphology QTL 1	4.18		aorta morphology trait (VT:0000272)	artery lesion measurement (CMO:0000975)	13	14441582	50799665	Rat
2302275	Gluco37	Glucose level QTL 37	3.8		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	13	14441582	51577031	Rat
2317040	Aia21	Adjuvant induced arthritis QTL 21	2.75		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	13	14624631	59624631	Rat
2317046	Aia8	Adjuvant induced arthritis QTL 8	3.9700000286102295		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	13	14624631	59624631	Rat
631645	Bp121	Blood pressure QTL 121	3.3		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	19810814	64810814	Rat
9589164	Gluco66	Glucose level QTL 66	6.67	0.001	blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	13	20052477	65052477	Rat
1331784	Bp222	Blood pressure QTL 222	2.944		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	21482481	58537177	Rat
7207885	Glom27	Glomerulus QTL 27	3.9		kidney glomerulus integrity trait (VT:0010546)	kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)	13	24502279	108770533	Rat
61391	Bp5	Blood pressure QTL 5	5.6		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	13	28008338	73008338	Rat
70170	Eae14	Experimental allergic encephalomyelitis QTL 14		0.0024	nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)	13	28584452	73584452	Rat
1558644	Cm45	Cardiac mass QTL 45	3.6	0.002	heart mass (VT:0007028)	heart wet weight (CMO:0000069)	13	29076934	74076934	Rat
6893338	Cm76	Cardiac mass QTL 76	0	0.99	heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	13	29076934	74076934	Rat
1354621	Rf47	Renal function QTL 47	3.7		kidney renin amount (VT:0010559)	kidney renin level (CMO:0002166)	13	35301263	107975663	Rat
2301962	Cm72	Cardiac mass QTL 72	4.12		heart left ventricle mass (VT:0007031)	heart left ventricle weight (CMO:0000776)	13	36147533	64868393	Rat
70181	BpQTLcluster11	Blood pressure QTL cluster 11	6.922		arterial blood pressure trait (VT:2000000)	absolute change in mean arterial blood pressure (CMO:0000533)	13	36147533	99968921	Rat
70181	BpQTLcluster11	Blood pressure QTL cluster 11	6.922		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	36147533	99968921	Rat
70181	BpQTLcluster11	Blood pressure QTL cluster 11	6.922		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	36147533	99968921	Rat
70181	BpQTLcluster11	Blood pressure QTL cluster 11	6.922		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	13	36147533	99968921	Rat
2303563	Bw89	Body weight QTL 89	6		body mass (VT:0001259)	body weight (CMO:0000012)	13	37346348	82346348	Rat
61340	Bp25	Blood pressure QTL 25	4.2	0.004	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	39372927	84372927	Rat
10755495	Bp387	Blood pressure QTL 387	3.78		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	39501300	93652524	Rat
4889861	Pur29	Proteinuria QTL 29	13.8	0.005	total urine protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	13	42310744	86833540	Rat
1331750	Bp220	Blood pressure QTL 220	2.98		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	13	42310744	87310744	Rat
70220	Bp55	Blood pressure QTL 55	5.75		arterial blood pressure trait (VT:2000000)	blood pressure measurement (CMO:0000003)	13	42508345	87508345	Rat
61349	Bp31	Blood pressure QTL 31	5.75		arterial blood pressure trait (VT:2000000)	blood pressure measurement (CMO:0000003)	13	42508345	87508345	Rat
1549897	Stresp12	Stress response QTL 12	3.35		stress-related behavior trait (VT:0010451)	number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)	13	43575717	88575717	Rat
619615	Bp80	Blood pressure QTL 80		0.0354	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	45676629	90676629	Rat
2303032	Bp328	Blood pressure QTL 328			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	46444570	50799665	Rat
4145117	Mcs27	Mammary carcinoma susceptibility QTL 27		0.0001	mammary gland integrity trait (VT:0010552)	post-insult time to mammary tumor formation (CMO:0000345)	13	48776655	53264877	Rat
6893344	Cm79	Cardiac mass QTL 79	1.5	0.04	heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	13	49058507	67207219	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	304791	UniSTS
UniSTS	111964	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description: