Marker: D8Got3 |
| Symbol: |
D8Got3 |
| Previously known as: |
OT50.40; oxsts2602;
|
| RGD ID: |
44364 |
| Expected Size: |
258 (bp) |
| Position |
| Rat Assembly | Chr | Position (strand) | Source | JBrowse |
|---|
mRatBN7.2 | 8 | 1,798,512 - 1,798,770 (+) | MAPPER | mRatBN7.2 | Rnor_6.0 | 8 | 1,813,140 - 1,813,397 | NCBI | Rnor6.0 | Rnor_5.0 | 8 | 1,834,282 - 1,834,539 | UniSTS | Rnor5.0 | RGSC_v3.4 | 8 | 1,194,468 - 1,194,725 | RGD | RGSC3.4 | RGSC_v3.4 | 8 | 1,194,469 - 1,194,726 | UniSTS | RGSC3.4 | RGSC_v3.1 | 8 | 1,194,468 - 1,194,725 | RGD | | Celera | 8 | 1,680,170 - 1,680,427 | UniSTS | | RH 2.0 Map | 8 | 0.0 | RGD | | Cytogenetic Map | 8 | q11 | UniSTS | |
|
| Is Marker For: |
Genes:
Gria4
|
Annotation
References - curated
| # |
Reference Title |
Reference Citation |
| 1. |
Data downloaded from Wellcome Trust, University of Oxford |
Data downloaded from Wellcome Trust, University of Oxford
|
| 2. |
UniSTS Pipeline |
RGD automated pipelines
|
| 3. |
RH Map Project |
RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
|
| 4. |
A high density integrated genetic linkage and radiation hybrid map of the laboratory rat |
Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
|
Strains and Sequence
Sequence
| |
| Forward Primer |
CGATCCAGTTTCCCTCAAGT |
| Reverse Primer |
TCTCATAGCTCAGAAAATGAAGTGA |
| |
Region
Genes in Region
| 61863 | Gria4 | glutamate ionotropic receptor AMPA type subunit 4 | 8 | 1562118 | 2035035 | Rat | |
QTLs in Region (mRatBN7.2)
| 71120 | Niddm21 | Non-insulin dependent diabetes mellitus QTL 21 | 3.73 | | blood glucose amount (VT:0000188) | plasma glucose level (CMO:0000042) | 8 | 1 | 3402289 | Rat | | 9590084 | Insglur5 | Insulin/glucose ratio QTL 5 | 18.54 | 0.001 | blood insulin amount (VT:0001560) | calculated plasma insulin level (CMO:0002170) | 8 | 1 | 24597739 | Rat | | 2317882 | Alcrsp24 | Alcohol response QTL 24 | 3.2 | 0.05 | response to alcohol trait (VT:0010489) | duration of loss of righting reflex (CMO:0002289) | 8 | 1 | 25902202 | Rat | |
