D7Got85 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D7Got85

Symbol: D7Got85
Previously known as: oxsts2479; OT78.06; 
RGD ID: 44283
Expected Size: 143 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.27100,006,584 - 100,006,727 (+)MAPPERmRatBN7.2
Rnor_6.07109,157,626 - 109,157,768NCBIRnor6.0
Rnor_5.07109,100,455 - 109,100,597UniSTSRnor5.0
RGSC_v3.47105,689,751 - 105,689,893RGDRGSC3.4
RGSC_v3.47105,689,751 - 105,689,893UniSTSRGSC3.4
RGSC_v3.17105,723,981 - 105,724,123RGD
Celera796,518,065 - 96,518,207UniSTS
RH 3.4 Map7688.0RGD
RH 3.4 Map7688.0UniSTS
RH 2.0 Map7527.5RGD
Cytogenetic Map7q34UniSTS
Is Marker For: Genes:   Zfat  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer CGATCTCTTCATCTCCCTATGC
Reverse Primer CTCCTACCAACTTATGGCCC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1310886Zfatzinc finger and AT hook domain containing799886954100054288Rat

Nucleotide Sequences
GenBank Nucleotide AU025435 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH616118.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)7924703115097879Rat
61357Bp38Blood pressure QTL 381.60.052arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)741333674119109060Rat
1358361Sradr5Stress Responsive Adrenal Weight QTL 55.55adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)743747012108555253Rat
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)743747012135012528Rat
1300149Cm6Cardiac mass QTL 64.09heart mass (VT:0007028)heart left ventricle weight to body weight ratio (CMO:0000530)743747099102228765Rat
631504Cm27Cardiac mass QTL 273.45heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)744421311118198041Rat
1300151Bp181Blood pressure QTL 1813.36arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)753612714103945643Rat
2317035Aia16Adjuvant induced arthritis QTL 162.71joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)759238038104238038Rat
1298528Bp169Blood pressure QTL 1690.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)761074194106074194Rat
1559283Emca4Estrogen-induced mammary cancer QTL 43.7mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)762004452101773158Rat
1576303Ept7Estrogen-induced pituitary tumorigenesis QTL 73.7pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)762004452101773158Rat
70173Niddm19Non-insulin dependent diabetes mellitus QTL 194.330.00005blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)764002457135012528Rat
2316947Rf58Renal function QTL 587.8kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)768938720113886318Rat
2316952Pur22Proteinuria QTL 225.2urine protein amount (VT:0005160)urine protein level (CMO:0000591)768938720113886318Rat
2316955Stl24Serum triglyceride level QTL 247.1blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)768938720113886318Rat
631540Bw9Body weight QTL 94.5body mass (VT:0001259)body weight (CMO:0000012)769736226117455174Rat
1357338Stl17Serum triglyceride level QTL 173.23blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)769736356112729554Rat
634331Pia17Pristane induced arthritis QTL 174.7joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)773829340130221005Rat
7411654Foco25Food consumption QTL 259.30.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)775918751120918751Rat
7411607Foco15Food consumption QTL 150.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)775918751120918751Rat
631529Tls2T-lymphoma susceptibility QTL 200.001thymus integrity trait (VT:0010555)percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)780221299109401111Rat
1331746Kidm9Kidney mass QTL 93.934kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)780221299112308525Rat
1331728Bp214Blood pressure QTL 2142.825arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)780221299124373579Rat
1331768Kidm10Kidney mass QTL 104.62096kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)780221299125221299Rat
2317052Aia17Adjuvant induced arthritis QTL 172.13joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)781737938126737938Rat
634322Bw12Body weight QTL 120body mass (VT:0001259)body weight (CMO:0000012)783153392128153392Rat
1358891Bp265Blood pressure QTL 2652.21arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)783591953134666232Rat
1358914Bp266Blood pressure QTL 266arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)783591953134666232Rat
71114Niddm14Non-insulin dependent diabetes mellitus QTL 144.5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)784257275129257275Rat
2298475Eau6Experimental allergic uveoretinitis QTL 60.0029uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)784257275129257275Rat
1558655Swd4Spike wave discharge measurement QTL 43.680.0002brain electrophysiology trait (VT:0010557)brain spike-and-wave discharge severity grade (CMO:0001988)786983365131983365Rat
10450828Scl79Serum cholesterol level QTL 793.50.001blood HDL cholesterol amount (VT:0000184)blood low density lipoprotein cholesterol level (CMO:0000053)789867376101773158Rat
1549899Stresp8Stress response QTL 84.370.0008stress-related behavior trait (VT:0010451)defensive burying duration (CMO:0001961)790482196135012528Rat
2299163Iddm34Insulin dependent diabetes mellitus QTL 342.71blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)791281130135012528Rat
631687Hcas1Hepatocarcinoma susceptibility QTL 13.90.001liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)791412594129807172Rat
61397Bw17Body weight QTL 176.3body mass (VT:0001259)body weight (CMO:0000012)793595647106839474Rat
2313102Bmd79Bone mineral density QTL 792.30.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)794811085116738842Rat
1357336Gluco6Glucose level QTL 63.4blood glucose amount (VT:0000188)serum glucose level (CMO:0000543)794811326116294265Rat
731176Glom5Glomerulus QTL 52.50.0035kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)796670164135012528Rat
1298525Cm1Cardiac mass QTL 12.7heart mass (VT:0007028)heart wet weight (CMO:0000069)799736187103146217Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 362925 UniSTS
UniSTS 115267 UniSTS