D1Got86 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Got86

Symbol: D1Got86
Previously known as: oxsts152; OT49.39; 
RGD ID: 43257
Expected Size: 108 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21133,935,205 - 133,935,265 (+)MAPPERmRatBN7.2
mRatBN7.2185,929,313 - 85,929,421 (+)MAPPERmRatBN7.2
Rnor_6.0189,130,289 - 89,130,396NCBIRnor6.0
Rnor_5.0190,285,218 - 90,285,325UniSTSRnor5.0
RGSC_v3.4185,723,959 - 85,724,067RGDRGSC3.4
RGSC_v3.4185,723,960 - 85,724,067UniSTSRGSC3.4
RGSC_v3.1185,802,070 - 85,802,178RGD
Celera180,300,993 - 80,301,100UniSTS
RH 3.4 Map1844.8RGD
RH 3.4 Map1844.8UniSTS
RH 2.0 Map1545.2RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer CACTCACAGGTTCACAGGCA
Reverse Primer TCGATCTGTGTGTTAGCAGAGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3083Mfge8milk fat globule EGF and factor V/VIII domain containing1133064665133080069Rat
68948Bcat2branched chain amino acid transaminase 219604040796060008Rat
61811FcgrtFc gamma receptor and transporter19557443695584171Rat
61813Ftl1ferritin light chain 119593638795938234Rat
3627Clec11aC-type lectin domain containing 11A19480045694809002Rat
3631Scn1bsodium voltage-gated channel beta subunit 118635391786363820Rat
62035Cd37CD37 molecule19571917195724662Rat
2955Kcnc1potassium voltage-gated channel subfamily C member 119690295396944744Rat
71092Csrp3cysteine and glycine rich protein 319852806798546647Rat
2294Ccne1cyclin E119078194790791188Rat
2326CebpaCCAAT/enhancer binding protein alpha18775963187762303Rat
2177Atp4aATPase H+/K+ transporting subunit alpha18596160785974972Rat
61859Gabra5gamma-aminobutyric acid type A receptor subunit alpha 51108268728108381670Rat
69247Kcnj11potassium inwardly-rectifying channel, subfamily J, member 1119659104896594574Rat
619905Slc7a9solute carrier family 7 member 918810951788132653Rat
70971Hamphepcidin antimicrobial peptide18617092686172865Rat
3214Ntrk3neurotrophic receptor tyrosine kinase 31132116472132503849Rat
3448Ptpn5protein tyrosine phosphatase, non-receptor type 519762063897681186Rat
3909Tsg101tumor susceptibility 10119741268997442589Rat
61982Hpnhepsin18633708586352785Rat
2869Igf1rinsulin-like growth factor 1 receptor1121549831121838548Rat
2639Fut2fucosyltransferase 219611954996139567Rat
69305Nr2f2nuclear receptor subfamily 2, group F, member 21124008282124022521Rat
69306Fxyd1FXYD domain-containing ion transport regulator 118628716386291478Rat
619729Lrp3LDL receptor related protein 318784381587859147Rat
620054Ppfia3PTPRF interacting protein alpha 319581711095845950Rat
620057PolgDNA polymerase gamma, catalytic subunit1133382764133399578Rat
3006Lhbluteinizing hormone subunit beta19589826995901973Rat
3786Abcc8ATP binding cassette subfamily C member 819659856896679563Rat
61906Nr1h2nuclear receptor subfamily 1, group H, member 219504196795047358Rat
3035Magmyelin-associated glycoprotein18614822786163726Rat
619938Nup62nucleoporin 6219529899595314902Rat
62020Prmt1protein arginine methyltransferase 119545885395468176Rat
3888Klk1c2kallikrein 1-related peptidase C219449233294496480Rat
2969Klk1kallikrein 119464264494646760Rat
2651Gabrb3gamma-aminobutyric acid type A receptor subunit beta 31108467047108702522Rat
2330CebpgCCAAT/enhancer binding protein gamma18768306087692772Rat
3212Ntf4neurotrophin 419589356095896391Rat
69366Ldhclactate dehydrogenase C19738598497403382Rat
3895Tph1tryptophan hydroxylase 119715737597178415Rat
621026Rps11ribosomal protein S1119560569095607798Rat
3175Klk1b3kallikrein 1-related peptidase B319470910594713308Rat
619842Pex11aperoxisomal biogenesis factor 11 alpha1133680091133687172Rat
620030Nucb1nucleobindin 119596832595999183Rat
631429Myod1myogenic differentiation 119688486496887574Rat
632282Mrgprx3MAS related GPR family member X319772037797746953Rat
68358Acanaggrecan1132981582133044416Rat
61940Napsanapsin A aspartic peptidase19506472695077101Rat
621358Kcnc3potassium voltage-gated channel subfamily C member 319508096095095165Rat
628897Selenosselenoprotein S1119659779119669546Rat
2740Grin2dglutamate ionotropic receptor NMDA type subunit 2D19630687196346994Rat
620398Cyth2cytohesin 219628318296291094Rat
620244Trpm4transient receptor potential cation channel, subfamily M, member 419578180595812095Rat
628697Rpl13aribosomal protein L13A19560937495612557Rat
620101Slc17a7solute carrier family 17 member 719564970995661591Rat
632284Mrgprx1MAS related GPR family member X119780609997807070Rat
620830Fxyd7FXYD domain-containing ion transport regulator 718627767886286954Rat
69236Lsrlipolysis stimulated lipoprotein receptor18618576986201952Rat
621523Nkg7natural killer cell granule protein 719384474893845975Rat
620150Gapdhsglyceraldehyde-3-phosphate dehydrogenase, spermatogenic18597909685994153Rat
620175Fgf21fibroblast growth factor 2119608336096084911Rat
727784Tskstestis-specific serine kinase substrate19541431295441670Rat
735035Lgi4leucine-rich repeat LGI family, member 418629453986305909Rat
3419Klk6kallikrein related-peptidase 619427886394286136Rat
620531Slc17a6solute carrier family 17 member 61101212489101252543Rat
619716Sv2bsynaptic vesicle glycoprotein 2b1128978471129152479Rat
620975Usf2upstream transcription factor 2, c-fos interacting18617470386185942Rat
71086Krtdapkeratinocyte differentiation associated protein18603829686041594Rat
2348Chrna7cholinergic receptor nicotinic alpha 7 subunit1116711559116837269Rat
620998Nell1neural EGFL like 1199709305100573872Rat
2991Anpepalanyl aminopeptidase, membrane1133767332133810137Rat
2996Ldhalactate dehydrogenase A19737182397381247Rat
628872Kcnj14potassium inwardly-rectifying channel, subfamily J, member 1419629315996300810Rat
621094Emp3epithelial membrane protein 319638865196391946Rat
621482Lim2lens intrinsic membrane protein 219383759793843769Rat
621011Shank1SH3 and multiple ankyrin repeat domains 119480787994857356Rat
727893Akap13A-kinase anchoring protein 131129313183129619647Rat
1303192Klk1c12kallikrein 1-related peptidase C1219437810394382140Rat
1303214Emc10ER membrane protein complex subunit 1019498026094988847Rat
1303220Klk1c6kallikrein 1-related peptidase C619446762694475842Rat
621526Ppp1r15aprotein phosphatase 1, regulatory subunit 15A19600005396003128Rat
2192BaxBCL2 associated X, apoptosis regulator19594000195945407Rat
1303242Klk10kallikrein related-peptidase 1019423453694239369Rat
2727Gpiglucose-6-phosphate isomerase18682821186856077Rat
1304831Il4i1interleukin 4 induced 119529945795324564Rat
620845Apba2amyloid beta precursor protein binding family A member 21118053270118286858Rat
620730Lin7blin-7 homolog B, crumbs cell polarity complex component19584688895849628Rat
619778Nav2neuron navigator 219895762999322339Rat
69269SnurfSNRPN upstream open reading frame1111101327111123634Rat
727872Synmsynemin1121333712121363652Rat
3351Plin1perilipin 11133664294133676854Rat
620227Slco3a1solute carrier organic anion transporter family, member 3a11128106232128388043Rat
621672Slc7a10solute carrier family 7 member 1018782908487845073Rat
2491DbpD-box binding PAR bZIP transcription factor19617579696180745Rat
735133Plekha4pleckstrin homology domain containing A419600582496028826Rat
628613Ffar1free fatty acid receptor 118611136886112272Rat
727805Klk1c9kallikrein 1-related peptidase C919459735994601245Rat
2638Fut1fucosyltransferase 119608693496090352Rat
621306Snrpnsmall nuclear ribonucleoprotein polypeptide N1111101327111123400Rat
621824Slc6a5solute carrier family 6 member 519964538999697016Rat
1306821Myh14myosin heavy chain 1419509626695158861Rat
621735Gabrg3gamma-aminobutyric acid type A receptor subunit gamma 31107627450108247483Rat
620268Abcc6ATP binding cassette subfamily C member 619644722496501464Rat
620827Fxyd5FXYD domain-containing ion transport regulator 518626793786277329Rat
621182Rpl18ribosomal protein L1819618881196191452Rat
1303329Ush1cUSH1 protein network component harmonin19669530396743671Rat
1303331Pnkppolynucleotide kinase 3'-phosphatase19534146595346921Rat
1303312Etfbelectron transfer flavoprotein subunit beta19385190893866072Rat
621839Pold1DNA polymerase delta 1, catalytic subunit19502546295041559Rat
1305013Tmem143transmembrane protein 14319637193496387991Rat
735032Klk1c3kallikrein 1-related peptidase C319467163694675417Rat
1305154Asb7ankyrin repeat and SOCS box-containing 71120222835120267411Rat
1305084Zfp473zinc finger protein 47319522268395243328Rat
1306322Tshz3teashirt zinc finger homeobox 318938673289460719Rat
1306764Kdelr1KDEL endoplasmic reticulum protein retention receptor 119634725896358145Rat
708405Scaf1SR-related CTD-associated factor 119548544895499389Rat
727864Hrchistidine rich calcium binding protein19581326295816987Rat
1304706Tmem147transmembrane protein 14718597702885978848Rat
621843St8sia2ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 21127762573127838017Rat
1305695Lsm14aLSM14A mRNA processing body assembly factor18696480087009325Rat
1308541TicrrTOPBP1-interacting checkpoint and replication regulator1133597618133639513Rat
1306361Ube3aubiquitin protein ligase E3A1110070260110161675Rat
1306610Otogotogelin19674633696815416Rat
1306051Nipa2NIPA magnesium transporter 21106799979106824206Rat
1306407Isg20interferon stimulated exonuclease gene 201132829303132837027Rat
620413Prmt3protein arginine methyltransferase 319949271299581774Rat
1306420Klk7kallikrein-related peptidase 719426717094271361Rat
1305137Med25mediator complex subunit 2519535996195375827Rat
1309941Htatip2HIV-1 Tat interactive protein 219947341199488632Rat
1305051Aenapoptosis enhancing nuclease1132815094132824522Rat
1305749Tmem86atransmembrane protein 86A19759591097600260Rat
1307441Siglec10sialic acid binding Ig-like lectin 1019381730193826376Rat
1307361Bcl2l12Bcl2 like 1219547227295480991Rat
1307017Zfp507zinc finger protein 50718843578788468577Rat
628902Atf5activating transcription factor 519529560295299755Rat
738043Mrgprb4MAS-related GPR, member B419785270497853675Rat
738048Mrgprx2MAS related GPR family member X219811619298135534Rat
738051Mrgprb13MAS-related GPR, member B1319804101398041999Rat
738052Mrgprb5MAS-related G protein-coupled receptor, member B519795919397960254Rat
738053Mrgprx2lMAS-related G protein-coupled receptor, member X2-like19818544198186385Rat
1302935Nudt19nudix hydrolase 1918821447588226072Rat
1310608Fuzfuzzy planar cell polarity protein19537954295384532Rat
1307371Saa4serum amyloid A419724758097251882Rat
1308000Lrrk1leucine-rich repeat kinase 11119844360119972885Rat
1307737Syngr4synaptogyrin 419635867996371840Rat
1305384Cpt1ccarnitine palmitoyltransferase 1c19544281495457347Rat
1305344Iglon5IgLON family member 519388090693898929Rat
1307209Lrrc28leucine rich repeat containing 281121116833121245805Rat
1305998Klk8kallikrein related-peptidase 819425180394258646Rat
1306411WtipWT1 interacting protein18673121486764939Rat
1304689Tubgcp5tubulin gamma complex component 51106636526106672175Rat
1307757Sphk2sphingosine kinase 219618087296188592Rat
1307120Snrnp70small nuclear ribonucleoprotein U1 subunit 7019585603895876434Rat
1307121Lrrc4bleucine rich repeat containing 4B19492203494956309Rat
3246Pcsk6proprotein convertase subtilisin/kexin type 61119428978119627626Rat
620825Fxyd3FXYD domain-containing ion transport regulator 318630553186312455Rat
1306305Tjp1tight junction protein 11118849838119094492Rat
1311983Rgmarepulsive guidance molecule BMP co-receptor a1127128934127172918Rat
1311610Cd22CD22 molecule18611637686132782Rat
1308098Hapln3hyaluronan and proteoglycan link protein 31133046465133064665Rat
1310526Ndnnecdin, MAGE family member1115849168115850767Rat
1308428Garre1granule associated Rac and RHOG effector 118686212186939725Rat
1308935Gpatch1G patch domain containing 118792560687974544Rat
1310401Siglechsialic acid binding Ig-like lectin H1106593721106604191Rat
1309649Rlbp1retinaldehyde binding protein 11133308920133322296Rat
1309316Fam83efamily with sequence similarity 83, member E19619158196201182Rat
1359365Rcn3reticulocalbin 319556450395573762Rat
1311904Chsy1chondroitin sulfate synthase 11119689626119750711Rat
1309736Zdhhc13zinc finger DHHC-type palmitoyltransferase 1319848731998525906Rat
1303228Klk4kallikrein-related peptidase 419434419594349425Rat
1310995Klk15kallikrein-related peptidase 1519469942294706626Rat
1311142Garin5agolgi associated RAB2 interactor 5A19498895994995971Rat
1310332Cyfip1cytoplasmic FMR1 interacting protein 11106710924106799393Rat
1308334Dpy19l3dpy-19 like C-mannosyltransferase 318835030388417339Rat
628662Aldh1a3aldehyde dehydrogenase 1 family, member A31119982272120017416Rat
1310815Klhl25kelch-like family member 251129724894129750142Rat
1312049Akt1s1AKT1 substrate 119533318695339678Rat
1309036C1h19orf81simlar to human chromosome 19 open reading frame 8119485730194871323Rat
1359360Mef2amyocyte enhancer factor 2a1120847874120982488Rat
1308366Rhpn2rhophilin, Rho GTPase binding protein 218799114388051895Rat
1311751Mesp1mesoderm posterior bHLH transcription factor 11133738357133739875Rat
1311531Scgb1b30secretoglobin, family 1B, member 3018671751086718775Rat
1310409Ttc23tetratricopeptide repeat domain 231121245996121329500Rat
1549774Irf3interferon regulatory factor 319547996695484926Rat
1309632Kcna7potassium voltage-gated channel subfamily A member 719588607395891565Rat
1306509Ruvbl2RuvB-like AAA ATPase 219590201495915247Rat
1309793Det1DET1 partner of COP1 E3 ubiquitin ligase1132749736132765963Rat
1308606Klk14kallikrein related-peptidase 1419412313194137239Rat
1305444Prrg2proline rich and Gla domain 219553427695543364Rat
1309966Mceemethylmalonyl CoA epimerase1117964576117987779Rat
1308280Klk9kallikrein related-peptidase 919424633994250631Rat
1305240Nomo1Nodal modulator 119650546096556280Rat
1307633Mphosph10M-phase phosphoprotein 101117948134117964149Rat
1308225Gtf2h1general transcription factor IIH subunit 119732141797349455Rat
1308896Dbx1developing brain homeobox 119934863899354173Rat
1311308Tars3threonyl-tRNA synthetase 31119213189119265492Rat
1306235Vstm2bV-set and transmembrane domain containing 2B19259207092620491Rat
1309992Nosipnitric oxide synthase interacting protein19554332995559101Rat
1308975Klk12kallikrein related-peptidase 1219422277894227637Rat
1309206Nsmce3NSE3 homolog, SMC5-SMC6 complex component1118401302118402629Rat
1308690Klk11kallikrein related-peptidase 1119422874194233281Rat
1305955Pop4POP4 homolog, ribonuclease P/MRP subunit19096002690968360Rat
1305958Mtmr10myotubularin related protein 101117859355117910839Rat
1305959Mesp2mesoderm posterior bHLH transcription factor 21133756601133759207Rat
1310111Aspdhaspartate dehydrogenase domain containing19495632794960722Rat
1310561Pdcd5programmed cell death 518830586988311200Rat
1307989Herc2HECT and RLD domain containing E3 ubiquitin protein ligase 21106904789107110997Rat
1308141Odad1outer dynein arm docking complex subunit 119639213296420926Rat
727859RhcgRh family, C glycoprotein1133531704133555902Rat
1307305Josd2Josephin domain containing 219496086794964751Rat
1306254Ap2a1adaptor related protein complex 2 subunit alpha 119538430695414170Rat
1308740Ctu1cytosolic thiouridylase subunit 119411543194121224Rat
1308091E2f8E2F transcription factor 819856571798584265Rat
1310649Grwd1glutamate-rich WD repeat containing 119630126096306962Rat
1306977Ptov1PTOV1, extended AT-hook containing adaptor protein19534706595354514Rat
1305432Siglec5sialic acid binding Ig-like lectin 519376819093776696Rat
1309326Fv1Friend virus susceptibility 119473083994736791Rat
1309686Tbc1d17TBC1 domain family, member 1719532477095333156Rat
1307106Ankrd27ankyrin repeat domain 2718825121688303615Rat
1309337Klk13kallikrein related-peptidase 1319416538194177002Rat
1310310Kif7kinesin family member 71133639487133658539Rat
1310358Uri1URI1, prefoldin-like chaperone19064639290704811Rat
1308792Lins1lines homolog 11120267586120295013Rat
1308270Acp4acid phosphatase 419473637694751871Rat
1308783Adamts17ADAM metallopeptidase with thrombospondin type 1 motif, 171120445800120768204Rat
1305401Nipa1NIPA magnesium transporter 11106834000106875148Rat
1307664Peg12paternally expressed 121115962511115965114Rat
1305291Rasip1Ras interacting protein 119609713596109564Rat
1309564Zfp819zinc finger protein 81919402734794048767Rat
1311389Abhd2abhydrolase domain containing 2, acylglycerol lipase1133217403133298564Rat
1310544Plekhf1pleckstrin homology and FYVE domain containing 119090830490915862Rat
1310551Tulp2TUB like protein 219596249695999775Rat
1332712Or5m12-ps1olfactory receptor family 5 subfamily M member 12, pseudogene 11123124617123125228Rat
1311763Arrdc4arrestin domain containing 41122369355122383351Rat
1311730Cep89centrosomal protein 8918805821188100114Rat
1308882Sult2b1sulfotransferase family 2B member 119620015596261295Rat
1308736Hmgn5bhigh mobility group nucleosome binding domain 5B1117222188117224158Rat
1305359Klk1c8kallikrein 1-related peptidase C819454777494552287Rat
1309896Prr12proline rich 1219551001595534002Rat
1306150Atp10aATPase phospholipid transporting 10A (putative)1109556760109730440Rat
1310056Chd2chromodomain helicase DNA binding protein 21127188146127317041Rat
1308979Chst8carbohydrate sulfotransferase 818729414487435900Rat
1563363Zfp536zinc finger protein 53619000035990463423Rat
1563905Rpl19-ps23ribosomal protein L19, pseudogene 2319516357095164284Rat
1559862Wdr93WD repeat domain 931133687254133737449Rat
1561430Abol1ABO, alpha 1-3-N-acetylgalactosaminyltransferase and alpha 1-3-galactosyltransferase like 118643908686442406Rat
1561403Klk1c10kallikrein 1-related peptidase C1019440299394407052Rat
1563497Sergefsecretion regulating guanine nucleotide exchange factor19694966097152529Rat
1560280Agbl1AGBL carboxypeptidase 11130043914130950739Rat
1563721Otud7aOTU deubiquitinase 7A1117064428117388217Rat
1564982Vsig10lV-set and immunoglobulin domain containing 10 like19387148793880157Rat
1565899SpibSpi-B transcription factor19501893995024804Rat
1563539Ceacam18CEA cell adhesion molecule 1819407103994085649Rat
1311916Hps5HPS5, biogenesis of lysosomal organelles complex 2 subunit 219728162697320945Rat
1560088Ndufb4l3NADH:ubiquinone oxidoreductase subunit B4 like 318747986787480354Rat
1562967Mctp2multiple C2 and transmembrane domain containing 21125769932126002886Rat
1563167Gas2growth arrest-specific 21101452361101582619Rat
1564265Ano5anoctamin 51101086490101187547Rat
1565669Vom2r38vomeronasal 2 receptor, 3819335855093420097Rat
1562402Rpl27al3ribosomal protein L27A like 318956303489563540Rat
15618854930433I11RiklRIKEN cDNA 4930433I11 gene like19267146192678000Rat
1359614Ffar2free fatty acid receptor 218607185586075049Rat
1311021Arpinactin-related protein 2/3 complex inhibitor1133864288133873124Rat
1311022Gramd1aGRAM domain containing 1A18636700186393348Rat
1309123Mrpl46mitochondrial ribosomal protein L461132698872132707639Rat
1309809Pih1d1PIH1 domain containing 119563959795645295Rat
1560730Mrgprb3lMAS-related GPR, member B3 like19837743398378401Rat
1311035Ffar3free fatty acid receptor 318610538886106728Rat
1562792Tdrd12tudor domain containing 1218813327188205729Rat
1311443RrasRAS related19550058295504362Rat
1312023Uba2ubiquitin-like modifier activating enzyme 218677523986802685Rat
1561338Slc6a16solute carrier family 6, member 1619572169095750191Rat
1549692Vrk3VRK serine/threonine kinase 319524334495270780Rat
1549713Scgb1b24secretoglobin, family 1B, member 2418652134886522498Rat
1559691Dnmt3a-ps3DNA methyltransferase 3 alpha, pseudogene 31107153094107163738Rat
1359129Scgb2b24-ps1secretoglobin, family 2B, member 24, pseudopgene 118670760286709529Rat
1559901Mrps11mitochondrial ribosomal protein S111132707601132717253Rat
1549752Scgb2b2secretoglobin, family 2B, member 218652803586530028Rat
1311596Mybpc2myosin binding protein C219499412195017584Rat
1311197Mkrn3makorin, ring finger protein, 31115926774115929288Rat
1559980Ccdc179coiled-coil domain containing 1791101600369101604288Rat
1560122Wdr88WD repeat domain 8818788431687924719Rat
1564719Faap24FA core complex associated protein 2418805152388057997Rat
1560154Scgb2b24secretoglobin, family 2B, member 2418658150486582416Rat
1562305Sbsnsuprabasin18597897086006034Rat
1561859Pgpep1lpyroglutamyl-peptidase I-like1121835243121868368Rat
1583028Snrpgl1small nuclear ribonucleoprotein polypeptide G like 118798262987983056Rat
1585050Ybx1-ps11Y box binding protein 1, pseudogene 111102914612102916158Rat
1564929Tm2d3TM2 domain containing 31119267194119277094Rat
1565432Svipsmall VCP interacting protein1101587128101592818Rat
1585077Stip1-ps1stress-induced phosphoprotein 1, pseudogene 11101898734101900378Rat
1565454Izumo1izumo sperm-oocyte fusion 119609081796096893Rat
1583954Hnrnpa1-ps16heterogeneous nuclear ribonucleoprotein A1, pseudogene 161106395841106397127Rat
1583735Top1-ps1DNA topoisomerase 1, pseudogene 11127423431127432141Rat
1583786Rpl26-ps7ribosomal protein L26, pseudogene 71127659594127660098Rat
1583787Mif-ps8macrophage migration inhibitory factor, pseudogene 81126777227126777631Rat
1583788Commd9-ps1COMM domain containing 9, pseudogene 11111426330111428933Rat
1583789Hsdl1-ps1hydroxysteroid dehydrogenase like 1, pseudogene 11108780156108781131Rat
1583792Rpl18a-ps4ribosomal protein L18A, pseudogene 41101322809101323617Rat
1583794Far1-ps1fatty acyl CoA reductase 1, pseudogene 119818881698190338Rat
1583796Fam32al1family with sequence similarity 32, member A like 119107958991083390Rat
1583798Kpna3-ps1karyopherin subunit alpha 3, pseudogene 118666586186667440Rat
1583799Hsp90aa1-ps10heat shock protein 90 alpha family class A member 1, pseudogene 1018663359986636012Rat
1585883Fam169bfamily with sequence similarity 169, member B1121878670121968272Rat
1563523Dkkl1dickkopf like acrosomal protein 119569401095699259Rat
1587398Mrgprb3MAS-related GPR, member B319827080098286263Rat
1585067Trim25-ps1tripartite motif-containing 25, pseudogene 11102350230102400041Rat
1587416UevldUEV and lactate/malate dehyrogenase domains19745418897486004Rat
1582830C1h2orf78similar to human chromosome 2 open reading frame 7819274378892752219Rat
1563073Siglec8sialic acid binding Ig-like lectin 819409273794103134Rat
1583906Sarnp-ps1SAP domain containing ribonucleoprotein, pseudogene 11108457981108458724Rat
1561747Rgs9bpregulator of G protein signaling 9 binding protein18824943888250151Rat
3805Syt3synaptotagmin 319488083594895518Rat
1566295Aldh16a1aldehyde dehydrogenase 16 family, member A119562672795639808Rat
1582815Agap1l1ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 like 119284049592856281Rat
1562619Izumo2IZUMO family member 219519645995209131Rat
1561206Slc25a19l1solute carrier family 25 member 19 like 11111433195111435231Rat
1566413Cldnd2claudin domain containing 219384853393851693Rat
1561972Kash5KASH domain containing 519566891895691353Rat
1563307Setl2SET-like protein 218644948286450302Rat
1566323Fan1FANCD2 and FANCI associated nuclease 11117915323117945044Rat
1565197Ntn5netrin 519615694896165997Rat
1582848Etf1-ps2eukaryotic translation termination factor 1, pseudogene 219266128392668713Rat
1561456FancfFA complementation group F1101449120101451936Rat
1564356Cers3ceramide synthase 31120316930120422926Rat
1565099Klf13KLF transcription factor 131117505857117536626Rat
1562492Slc6a21solute carrier family 6 member 2119575425795765854Rat
15829832200002J24RiklRIKEN cDNA 2200002J24 gene like18592663885949890Rat
1562499Sec1secretory blood group 119614339096164249Rat
1592985Entrep2endosomal transmembrane epsin interactor 21118288365118700514Rat
1583737Kctd15potassium channel tetramerization domain containing 1518725865887271979Rat
1588673Hsd17b14hydroxysteroid (17-beta) dehydrogenase 1419602922496039577Rat
1586888Ap3s2adaptor related protein complex 3 subunit sigma 21133818825133859269Rat
1592144Matr3-ps1matrin 3, pseudogene 11118609657118613368Rat
1588641Lmtk3lemur tyrosine kinase 319626105896280362Rat
1588652MamstrMEF2 activating motif and SAP domain containing transcriptional regulator19610971596116295Rat
1587464Spaca4sperm acrosome associated 419619551496196187Rat
1585208C1h19orf12similar to human chromosome 19 open reading frame 1219087357890887205Rat
1583615Magel2MAGE family member L21115880142115884684Rat
1559447Pth2parathyroid hormone 219566652595667174Rat
1585733LOC682259similar to Tetraspanin-7 (Tspan-7) (Transmembrane 4 superfamily member 2) (Cell surface glycoprotein A15) (T-cell acute lymphoblastic leukemia-associated antigen 1) (TALLA-1) (Membrane component, X chromosome, surface marker 1) (CD231 antigen)...1122232825122233599Rat
1584032Zfp939zinc finger protein 93919112835691142632Rat
1589798Gys1glycogen synthase 119591544395935292Rat
1561521Dmkndermokine18601323786031243Rat
1590620Cwc15-ps1CWC15 spliceosome-associated protein, pseudogene 11119335619119336345Rat
1589941Pdcd2lprogrammed cell death 2-like18681029286822554Rat
1590913Slc25a5-ps3solute carrier family 25 member 5, pseudogene 31106191309106192280Rat
1584044Caap1-ps1caspase activity and apoptosis inhibitor 1, pseudogene 119106999391077845Rat
1584053C1h2orf78l1similar to human chromosome 2 open reading frame 78 like 119105646491063841Rat
1585163Uqcrb-ps1ubiquinol-cytochrome c reductase binding protein, pseudogene 119101732891017808Rat
1587443Saal1serum amyloid A-like 119719868597218131Rat
1597345Zfp141zinc finger protein 14119313057493164293Rat
1597448Fam187bfamily with sequence similarity 187, member B18620523486219542Rat
1593461Klk5kallikrein related-peptidase 519429657494304768Rat
1596105Apbhandrogen-binding protein eta18658813786589425Rat
1593285Hspd1-ps7heat shock protein family D (Hsp60) member 1, pseudogene 71103645663103648170Rat
1593397Klk15-ps3kallikrein-related peptidase 15, pseudogene 319449917794505830Rat
1594860Saa3serum amyloid A 319721870697222150Rat
1596020Cd33CD33 molecule19393541893940452Rat
1596870Zc3h11a-ps2zinc finger CCCH-type containing 11A, pseudogene 21116013406116016461Rat
1588686Dhdhdihydrodiol dehydrogenase19595436195965262Rat
1596282Vmn2r116l-ps12vomeronasal 2, receptor 116 like, pseudogene 1219345631293545002Rat
1588614Ncr3lg1natural killer cell cytotoxicity receptor 3 ligand 119656566496581825Rat
1592887Lysmd4LysM domain containing 41120839180120845148Rat
1597332Vom2r37vomeronasal 2 receptor, 3719325799393318774Rat
1593252Tead2TEA domain transcription factor 219570236695719186Rat
1592552Uqcrbl1ubiquinol-cytochrome c reductase binding protein like 11133425137133425500Rat
1594571Pepdpeptidase D18753665087681233Rat
1598109Morf4l1-ps7mortality factor 4 like 1, pseudogene 71115975577115976718Rat
1591913Traf7-ps1TNF receptor associated factor 7, pseudogene 11115943129115945159Rat
1591914Ccdc137-ps1coiled-coil domain containing 137, pseudogene 11106199727106208762Rat
1591915Mrgprb2MAS-related GPR, member B219840114098403162Rat
1591916Mrpl32-ps1mitochondrial ribosomal protein L32, pseudogene 119079444290798694Rat
1596692Fam174bfamily with sequence similarity 174, member B1127515393127618591Rat
1597140Trpm1transient receptor potential cation channel, subfamily M, member 11117718896117835434Rat
1596303C1h2orf78-ps1similar to human chromosome 2 open reading frame 78, pseudogene 119282371492824634Rat
1598667Klk5l1kallikrein related-peptidase 5 like 119456668894571882Rat
735155Car11carbonic anhydrase 1119616990096175191Rat
1624201Zfp715zinc finger protein 71519370600593748131Rat
16424154933405O20RiklRIKEN cDNA 4933405O20 gene like1100300241100301711Rat
1626035Vom2r-ps62vomeronasal 2 receptor, pseudogene 621116129167116157652Rat
2316393Vom1r-ps67vomeronasal 1 receptor pseudogene 671131058349131059234Rat
2319766Lias-ps2lipoic acid synthetase, pseudogene 21108802590108803356Rat
2319415Spty2d1SPT2 chromatin protein domain containing 119753149597549616Rat
2320113Klk1c4kallikrein 1-related peptidase C419443457494438678Rat
2318883Snrpepl2small nuclear ribonucleoprotein polypeptide E like 21133709656133710137Rat
2318957Cdc42se2-ps1CDC42 small effector 2, pseudogene 119128740091290387Rat
2320229Set-ps1Set nuclear proto-oncogene, pseudogene 119775323397797449Rat
2318412Oca2OCA2 melanosomal transmembrane protein1107116278107446093Rat
2321314Atxn1-ps1ataxin 1, pseudogene 11102516795102517889Rat
2322090Ran-ps2RAN, member RAS oncogene family, pseudogene 219864557498655680Rat
2320559LOC100361204mas-related G-protein coupled receptor member B8-like19804940998050395Rat
2322792Flt3lgFms related receptor tyrosine kinase 3 ligand19561505695620463Rat
2320676Clp1-ps1cleavage factor polyribonucleotide kinase subunit 1, pseudogene 11105449881105451267Rat
2322257Rps27-ps9ribosomal protein S27, pseudogene 91128028275128028907Rat
2322933Srsf7-ps1serine and arginine rich splicing factor 7, pseudogene 11124210206124239378Rat
2320865Atxn1-ps2ataxin 1, pseudogene 21103672445103674674Rat
2320881Rpl36l2ribosomal protein L36 like 218606252586062968Rat
2323071Dcaf12-ps1DDB1 and CUL4 associated factor 12, pseudogene 11123731057123733750Rat
2322541Mrgprb13-ps1MAS-related GPR, member B13, pseudogene 119800209198004379Rat
2321863FanciFA complementation group I1133327264133383661Rat
2321930Grb2-ps1growth factor receptor bound protein 2, pseudogene 119301652893018833Rat
2320478Hsp90ab1-ps1heat shock protein 90 alpha family class B member 1, pseudogene 11105948734105951090Rat
2320494Snrpa1small nuclear ribonucleoprotein polypeptide A'1119641402119654653Rat
2324488Siglecl1SIGLEC family like 119391697193924742Rat
4888565Mir344a-2microRNA 344a-21115243128115243234Rat
2325398Mir8microRNA 81132806420132806514Rat
2325455Mir150microRNA 15019560502495605108Rat
2325463Mir9-3microRNA 9-31133440049133440138Rat
2325549Mir211microRNA 2111117777539117777644Rat
2325614Mir344-1microRNA 344-11115306861115306958Rat
4888550Mir344b-1microRNA 344b-11114623759114623856Rat
4888559Mir3597-3microRNA 3597-31133440038133440152Rat
6486569Mrgprb13-ps2MAS-related GPR, member B13, pseudogene 219803228298033552Rat
6488322LOC100912195protein BEX1-like1110047861110051812Rat
6485855Znf431l3zinc finger protein 431 like 319301932093038483Rat
6491878Misfamitochondrial sheath formation associated19752264197528961Rat
6485832Klk15-ps1kallikrein-related peptidase 15, pseudogene 119453388994545793Rat
6485896Zfp950l4zinc finger protein 950 like 419360728693628363Rat
6486156Zfp936zinc finger protein 93619294305992949011Rat
6491275Rhoq-ps1ras homolog family member Q, pseudogene 11106623061106624411Rat
6487791Pmis2PMIS2 transmembrane protein18593122085931993Rat
6498966Ybx1-ps5Y box binding protein 1, pseudogene 51102225708102227243Rat
6495781LOC10091088860S ribosomal protein L36-like1129764986129765341Rat
6495874LOC100910905uncharacterized LOC10091090518724982587251590Rat
6496163Luzp2leucine zipper protein 21105597291105983605Rat
6499588Znf599l-ps1zinc finger protein 599 like, pseudogene 118645346586484002Rat
6496810Ecsit-ps1ECSIT signaling integrator, pseudogene 11104502481104503645Rat
6500406Gfygolgi-associated, olfactory signaling regulator19566162195665300Rat
6500416Ftl1-ps1ferritin light chain 1, pseudogene 11100923579100924459Rat
6503647Rbm4b-ps1RNA binding motif protein 4B, pseudogene 11113739597113740013Rat
7489017Mir344gmicroRNA 344g1115343044115343122Rat
7489023Mir344imicroRNA 344i1115426210115426308Rat
7518732LOC102552287uncharacterized LOC1025522871103583677103601779Rat
7541917Zfp658zinc finger protein 65819399246794005689Rat
7505973LOC102548815uncharacterized LOC10254881519198240192029109Rat
7508565LOC102548323uncharacterized LOC1025483231116995976117064301Rat
7530616Mir9-3hgMir9-3 host gene1133431075133469302Rat
7510716Zfp719zinc finger protein 71919400995794027342Rat
7511549LOC102555775uncharacterized LOC1025557751114637762114649714Rat
7512548LOC102552153uncharacterized LOC1025521531103510363103575329Rat
7537804LOC102553800uncharacterized LOC1025538001131429410131442617Rat
7612387LOC102549305uncharacterized LOC1025493051119375739119389971Rat
7612505LOC102552286formyl peptide receptor-related sequence 4-like19474795394749932Rat
7631858Fbxw11-ps1F-box and WD repeat domain containing 11, pseudogene 11116428735116431543Rat
7634635LOC102555470uncharacterized LOC1025554701114294070114303084Rat
7634877LOC102554078uncharacterized LOC1025540781126851551126852404Rat
7650527LOC102555617uncharacterized LOC1025556171114440731114448803Rat
7651195LOC102550061uncharacterized LOC10255006119382681793836987Rat
7636379LOC102552634uncharacterized LOC10255263419734491797365236Rat
76363861700028J19RiklRIKEN cDNA 1700028J19 gene like19471361394730846Rat
7575724LOC102555770uncharacterized LOC10255577018780385387811246Rat
7577468LOC102549616uncharacterized LOC1025496161119804731119844038Rat
7625624LOC102548601uncharacterized LOC1025486011117601030117605930Rat
7655999LOC102549042uncharacterized LOC10254904219205174392123537Rat
7628264LOC102556190uncharacterized LOC10255619019604107496047337Rat
7660362LOC102551177uncharacterized LOC1025511771110294734111035350Rat
7661531LOC102553329uncharacterized LOC1025533291124017749124165290Rat
7555854Znf431l12zinc finger protein 431 like 1219365524793675372Rat
7591504LOC102551255tetraspanin-7-like1122231176122236101Rat
7598618LOC102548014uncharacterized LOC10254801419110575891128497Rat
7544339LOC102555866uncharacterized LOC1025558661114688298114932765Rat
7545650Potefam2POTE ankyrin domain family member 21116271482116447353Rat
7557829Klk15-ps2kallikrein-related peptidase 15, pseudogene 219458801894594577Rat
7580217Snrpb-ps1small nuclear ribonucleoprotein polypeptides B and B1, pseudogene 11115304693115305592Rat
7604390LOC102555648uncharacterized LOC10255564818769952187729062Rat
7554390LOC102547214uncharacterized LOC1025472141119348252119351951Rat
7692197LOC102547943uncharacterized LOC1025479431133414486133421488Rat
7676282LOC102553862uncharacterized LOC1025538621132019641132025235Rat
7676646Ube3al1ubiquitin protein ligase E3A like 11110158663110291293Rat
7704592Znf431l-ps8zinc finger protein 431 like, pseudogene 819288960692917697Rat
7683572Zfp619l1zinc finger protein 619 like 119117169791198293Rat
7683637LOC102553173uncharacterized LOC1025531731123943804123994246Rat
7690508Klk5l-ps1kallikrein related-peptidase 5 like, pseudogene 119447831494489098Rat
7683193LOC102549532uncharacterized LOC1025495321119755503119777201Rat
7730966LOC102552387uncharacterized LOC1025523871102647014102669486Rat
7731725LOC102552485uncharacterized LOC10255248519471984694730038Rat
7736966LOC10255718260S ribosomal protein L31-like19998035899982992Rat
7740165LOC102551020uncharacterized LOC1025510201122088458122164766Rat
7667275Klk2lkallikrein related-peptidase 2 like19442608394428521Rat
7716912Prdx3-ps1peroxiredoxin 3, pseudogene 11106775624106776566Rat
7742101LOC102547609uncharacterized LOC1025476091132868748132874634Rat
7697895LOC102546835uncharacterized LOC1025468351115475057115720360Rat
7698364LOC102553828spermatogenesis-associated protein 13-like1126159731126164254Rat
7698901LOC102554169uncharacterized LOC10255416918608184586086504Rat
7701959Zfp788zinc finger protein 78819317257593197706Rat
7721677LOC102546680uncharacterized LOC1025466801119181972119185546Rat
7747342LOC102546796uncharacterized LOC10254679619941626999427141Rat
7703231LOC102555707uncharacterized LOC10255570718779216987800501Rat
7748347Epb41l5-ps1erythrocyte membrane protein band 4.1 like 5, pseudogene 119658515196588057Rat
7709422Gapdh-ps69Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 691129758471129759490Rat
7750416Mgat4a-ps1alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase A, pseudogene 11113857991113864613Rat
7709992Csde1-ps1cold shock domain containing E1, pseudogene 11101128263101131688Rat
7710512Zfp619zinc finger protein 61919114801691167764Rat
7728972LOC102548165uncharacterized LOC1025481651116963210116996324Rat
9136205LOC103691157uncharacterized LOC1036911571121055568121061214Rat
9101016C1h19orf84similar to human chromosome 19 open reading frame 8419383537893837316Rat
9191646LOC103691162uncharacterized LOC1036911621126477043126482167Rat
9198344LOC103691146uncharacterized LOC1036911461114303744114386780Rat
9168486Rpl13a-ps3ribosomal protein L13A, pseudogene 319103627891036843Rat
9202400Ndufb4l5NADH:ubiquinone oxidoreductase subunit B4 like 519414821794148671Rat
9170070LOC103691133prostate-specific antigen-like19468179094685589Rat
9322177Fam24al1family with sequence similarity 24, member A like 11129641309129655041Rat
9283938Rhog-ps3ras homolog family member G, pseudogene 31111125687111208473Rat
9249251LOC103691177histone H2A.Z pseudogene1127473174127484619Rat
9421087Smim47small integral membrane protein 4719474463594746122Rat
9468236LOC103691168uncharacterized LOC1036911681132680421132684321Rat
10043390Rps27a-ps30ribosomal protein S27a, pseudogene 3019137172391372135Rat
11358405LOC108349566uncharacterized LOC10834956619070689690740913Rat
11462101Rps23-ps12ribosomal protein S23, pseudogene 1218689675686902505Rat
11463533LOC108349586uncharacterized LOC1083495861119287967119293388Rat
11465891LOC108349461uncharacterized LOC1083494611103443363103460555Rat
11468718Rpl21-ps25ribosomal protein L21, pseudogene 251124344834124345343Rat
11471669LOC108348727uncharacterized LOC1083487271106824340106838875Rat
11358633Trnat-agu1transfer RNA threonine (anticodon AGU) 118788302487883097Rat
11435664LOC10834943640S ribosomal protein S2 pseudogene18814039688141307Rat
11436011Zfp470zinc finger protein 47019106390591111883Rat
11436035Rpl27a-ps3ribosomal protein L27a, pseudogene 31133096265133099871Rat
11446352LOC108349560uncharacterized LOC10834956018643130286436167Rat
11366552Gapdhl11glyceraldehyde-3-phosphate dehydrogenase like 1119094057290941452Rat
11357821LOC108349455uncharacterized LOC10834945519248072492591739Rat
11360787Klk5l-ps3kallikrein related-peptidase 5 like, pseudogene 319439464594397275Rat
11452860Igsf22immunoglobulin superfamily member 2219760193897618144Rat
11432987LOC108349234uncharacterized LOC1083492341121251718121271532Rat
11422984LOC10834976860S ribosomal protein L29-like1108838092108838388Rat
11397546LOC108349597uncharacterized LOC1083495971130040995130043791Rat
11409293LOC108348964uncharacterized LOC1083489641106125962106135332Rat
11399620LOC108349549uncharacterized LOC10834954918615001286151717Rat
11388338LOC108349570uncharacterized LOC10834957019491568094923655Rat
11400164Klk5l2kallikrein related-peptidase 5 like 219465235394669527Rat
11411641LOC108349814high mobility group protein B1-like1130158350130158821Rat
11379739LOC108349564uncharacterized LOC10834956418938342289388116Rat
11390820LOC108349563uncharacterized LOC10834956318866079188701550Rat
11381349LOC108349450uncharacterized LOC10834945019091046590926453Rat
11393548LOC10834888060S ribosomal protein L34 pseudogene1106354560106354913Rat
11519974Trnae-uuc1transfer RNA glutamic acid (anticodon UUC) 11109313144109313215Rat
11502957LOC108349467uncharacterized LOC10834946718731898287324451Rat
11503785Trnar-ucg1transfer RNA arginine (anticodon UCG) 11133399712133399784Rat
11504974LOC108349103uncharacterized LOC10834910319008786390105749Rat
11496573Gpr32G protein-coupled receptor 3219475686394757895Rat
11517459LOC10834984960S ribosomal protein L7a pseudogene1129755848129757145Rat
11489695Tmsb10l5thymosin beta 10 like 51121497670121498138Rat
14398600Mir344b-3microRNA mir-344b-31114632635114632705Rat
14398575Mir344b-2microRNA mir-344b-21114616603114616673Rat
41321796LOC120100238small nucleolar RNA SNORD1151110292739110292816Rat
41322133LOC120100253small nucleolar RNA SNORD1151110267359110267436Rat
41354060LOC120100333small nucleolar RNA SNORD1161110995192110995284Rat
41378349Saal2serum amyloid A-like 219725763797259953Rat
41085628LOC120100308small nucleolar RNA SNORD1161110997780110997872Rat
41202669LOC120100280small nucleolar RNA SNORD1151110301514110301588Rat
41322568LOC120100492small nucleolar RNA U31117570637117570845Rat
41322932LOC120100155U6 spliceosomal RNA19106146191061567Rat
41323105LOC120100254small nucleolar RNA SNORD1151110269195110269271Rat
41356364LOC120100313small nucleolar RNA SNORD1161110479954110480046Rat
41087592LOC120099823uncharacterized LOC1200998231108581448108596320Rat
41088730Trnaa-agc79transfer RNA alanine (anticodon AGC) 791126350554126350634Rat
41113286LOC120100277small nucleolar RNA SNORD1151110290902110290979Rat
41113608LOC120100250small nucleolar RNA SNORD1151110257081110257158Rat
41284145Pole3-ps1DNA polymerase epsilon 3, accessory subunit, pseudogene 11107341034107356298Rat
41324388LOC120100247small nucleolar RNA SNORD1151110251568110251645Rat
41324480LOC120099827uncharacterized LOC1200998271113551559113562494Rat
41357392LOC120100282small nucleolar RNA SNORD1151110299683110299760Rat
41357901Snord35bsmall nucleolar RNA, C/D box 35B19560651095606596Rat
41382752LOC120099829uncharacterized LOC1200998291114066134114087090Rat
41141871LOC120099870uncharacterized LOC1200998701133872984133879902Rat
41169523LOC120099789uncharacterized LOC12009978918616126386163626Rat
41279059LOC120100281small nucleolar RNA SNORD1151110296410110296487Rat
41279797Cul4b-ps1cullin 4B, pseudogene 11133574646133575249Rat
41115833LOC120097732uncharacterized LOC12009773219151091991513005Rat
41142333Odc1-ps8ornithine decarboxylase 1, pseudogene 81109953728109955186Rat
41206771LOC120100249small nucleolar RNA SNORD1151110255243110255320Rat
41207249LOC120099846uncharacterized LOC1200998461122107156122110562Rat
41207608Isg20l1interferon stimulated exonuclease gene 20 like 119369267493701377Rat
41252911Trnas-aga17transfer RNA serine (anticodon AGA) 1719601179096011864Rat
41253898LOC120100276small nucleolar RNA SNORD1151110178175110178252Rat
41327125LOC120099822uncharacterized LOC1200998221108030936108068757Rat
41093297LOC120100213U7 small nuclear RNA1106488765106488826Rat
41118856LOC120100471small nucleolar RNA SNORD8819473460494734693Rat
41119470LOC120100326small nucleolar RNA SNORD1161110487777110487869Rat
41175336Brix1-ps1biogenesis of ribosomes BRX1, pseudogene 11129680951129683336Rat
41329310Dnajb6-ps5DnaJ heat shock protein family (Hsp40) member B6, pseudogene 51103619537103621184Rat
41330022LOC120099856uncharacterized LOC1200998561127413163127418868Rat
41364047LOC120099841uncharacterized LOC1200998411119204501119209290Rat
41389408LOC120098457kallikrein-2-like19451814894532064Rat
41389607Ipmk-ps1inositol polyphosphate multikinase, pseudogene 11127578732127592426Rat
41148090LOC120100271small nucleolar RNA SNORD1151110303346110303423Rat
41176080LOC120100323small nucleolar RNA SNORD1161111002979111003070Rat
41176983LOC120100210U7 small nuclear RNA1106488917106488976Rat
41211402LOC120100312small nucleolar RNA SNORD1161110982423110982515Rat
41212243LOC120099837uncharacterized LOC1200998371117663708117665914Rat
41364498Snord88bsmall nucleolar RNA, C/D box 88B19473493794735027Rat
41122044LOC120100336small nucleolar RNA SNORD1161111034987111035076Rat
41178707LOC120099844uncharacterized LOC1200998441121313138121320010Rat
41342901LOC120100321small nucleolar RNA SNORD1161110985002110985094Rat
41343058Gapdh-ps53Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 5319962205599623687Rat
41366411LOC120100318small nucleolar RNA SNORD1161110990216110990308Rat
41393201LOC120097268uncharacterized LOC1200972681110123926110128015Rat
41098464LOC120100402small nucleolar RNA SNORA481118424802118424943Rat
41123320LOC120100240small nucleolar RNA SNORD1151110208959110209036Rat
41154963Rpf1-ps1ribosome production factor 1, pseudogene 119479819794800311Rat
41179128LOC120099866uncharacterized LOC1200998661133470652133492131Rat
41179479LOC120099864uncharacterized LOC1200998641132956992132959786Rat
41179831LOC120100444small nucleolar RNA SNORA171108932965108933098Rat
41214457LOC120100258small nucleolar RNA SNORD1151110285396110285473Rat
41266353Snord64small nucleolar RNA, C/D box 641111094909111094975Rat
41343720LOC120097791uncharacterized LOC1200977911127962107127984875Rat
41099787LOC120099801uncharacterized LOC12009980119405836294073333Rat
41395739Nsa2-ps7NSA2 ribosome biogenesis factor, pseudogene 71100469200100469968Rat
41396804LOC120100331small nucleolar RNA SNORD1161110462563110462655Rat
41397269LOC120100315small nucleolar RNA SNORD1161110492982110493074Rat
41158753LOC120100275small nucleolar RNA SNORD1151110193908110193985Rat
41194726LOC120099792uncharacterized LOC12009979218717541287176845Rat
41218166LOC120100310small nucleolar RNA SNORD1161110972130110972222Rat
41268507LOC120100283small nucleolar RNA SNORD1151110182787110182865Rat
41269839Rpl6-ps17ribosomal protein L6, pseudogene 171107702837107711388Rat
41290328LOC120098456uncharacterized LOC12009845619412461594127467Rat
41345916LOC120100259small nucleolar RNA SNORD1151110225775110225852Rat
41346041Rnu6-968RNA, U6 small nuclear 96819089044290890548Rat
41347527Rnu6-1195RNA, U6 small nuclear 11951106391996106392102Rat
41347657LOC120099849uncharacterized LOC1200998491122862073122867551Rat
41070218LOC120099817uncharacterized LOC1200998171102476477102497194Rat
41103001LOC120100175U6 spliceosomal RNA19051132190511424Rat
41127338LOC120100339small nucleolar RNA Z195/SNORD33/SNORD32 family19561122295611304Rat
41185069LOC120100292small nucleolar RNA SNORD1151110197442110197520Rat
41219816LOC120099853uncharacterized LOC1200998531127336589127338218Rat
41292810Snord88csmall nucleolar RNA, C/D box 88C19473215594732245Rat
41104542LOC120100266small nucleolar RNA SNORD1151110223936110224013Rat
41129480LOC120097803uncharacterized LOC1200978031132925214132928678Rat
41271806Trnaa-agc61transfer RNA alanine (anticodon AGC) 611100836137100836210Rat
41401400LOC120099834uncharacterized LOC1200998341115051743115085815Rat
41073030LOC120100252small nucleolar RNA SNORD1151110260759110260836Rat
41081049LOC120100325small nucleolar RNA SNORD1161110485165110485257Rat
41130772LOC120100269small nucleolar RNA SNORD1151110214472110214549Rat
41198576LOC120097768uncharacterized LOC1200977681109198620109204581Rat
41230808LOC120099812uncharacterized LOC12009981219738377897386285Rat
41272992LOC120097339uncharacterized LOC1200973391120764055120770141Rat
41294442Snord35asmall nucleolar RNA, C/D box 35A19561018595610264Rat
41107959LOC120100450small nucleolar RNA SNORA1718786102287861136Rat
41108358LOC120100291small nucleolar RNA SNORD1151110322055110322131Rat
41131410LOC120100171U6 spliceosomal RNA19359441593594521Rat
41164166LOC120100400small nucleolar RNA SNORA481129979431129979573Rat
41200237LOC120100330small nucleolar RNA SNORD1161110495552110495645Rat
41275464LOC120097162uncharacterized LOC12009716219584503395849118Rat
41296176LOC120097775uncharacterized LOC1200977751115747262115755253Rat
41296445LOC120100337small nucleolar RNA SNORD1161111037433111037527Rat
41296733LOC120100341small nucleolar RNA SNORA701121176393121176525Rat
41352397Hmgb1-ps32high-mobility group box 1, pseudogene 3219797329497974178Rat
41084506LOC120099825uncharacterized LOC1200998251111424659111494106Rat
41084950LOC120100317small nucleolar RNA SNORD1161110469365110469457Rat
41110617LOC120100270small nucleolar RNA SNORD1151110210797110210874Rat
41136282LOC120100464small nucleolar RNA SNORA401119956733119956858Rat
41166428LOC120100376small nucleolar RNA SNORA2/SNORA34 family1104515030104515165Rat
41166596LOC120100265small nucleolar RNA SNORD1151110308960110309037Rat
41202226LOC120100150U6 spliceosomal RNA1106789754106789860Rat
41234278LOC120100290small nucleolar RNA SNORD1151110184594110184670Rat
40945041Trnaa-agc69transfer RNA alanine (anticodon AGC) 6919497229894972372Rat
40971092LOC120100305small nucleolar RNA SNORD1161110974703110974795Rat
40972134Trnap-cggtransfer RNA proline (anticodon CGG)19247162192471695Rat
40996824LOC120100273small nucleolar RNA SNORD1151110315578110315662Rat
40973162LOC120100241small nucleolar RNA SNORD1151110240543110240620Rat
40973358LOC120100244small nucleolar RNA SNORD1151110247891110247968Rat
41015843LOC120100242small nucleolar RNA SNORD1151110244217110244294Rat
40950485Snx4-ps1sorting nexin 4, pseudogene 11118719465118723782Rat
40974504Rps29-ps9ribosomal protein S29, pseudogene 91119451277119451561Rat
40975001LOC120099854uncharacterized LOC1200998541127347845127351622Rat
40952192LOC120099808uncharacterized LOC12009980819712204697126401Rat
40976304LOC120100448small nucleolar RNA SNORA171123620368123620504Rat
40976798Trnas-aga33transfer RNA serine (anticodon AGA) 3318702847987028559Rat
40977331Mrgprb4-ps1MAS-related GPR, member B4, pseudogene 119797848197980262Rat
41012795Snord88asmall nucleolar RNA, C/D box 88A19473429994734388Rat
41012988LOC120100329small nucleolar RNA SNORD1161110979851110979943Rat
41013486Rpl36-ps8ribosomal protein L36, pseudogene1117148209117148529Rat
40926109LOC120097340uncharacterized LOC1200973401120775852120778917Rat
40953130LOC12009778560S ribosomal protein L27-like1124728576124728938Rat
40953491LOC120100293small nucleolar RNA SNORD1151110200168110200253Rat
40978721LOC120099868uncharacterized LOC1200998681133652575133654456Rat
41015411LOC120100324small nucleolar RNA SNORD1161110482541110482633Rat
40927059LOC120100340small nucleolar RNA SNORD3419561043295610498Rat
40927834LOC120100306small nucleolar RNA SNORD1161110977274110977366Rat
40956054LOC120100387U2 spliceosomal RNA1113515184113515344Rat
40979199LOC120100272small nucleolar RNA SNORD1151110307020110307096Rat
40979258LOC120097159uncharacterized LOC12009715919570437495707794Rat
40999106LOC120100332small nucleolar RNA SNORD1161111005695111005787Rat
40999933LOC120100494U4 spliceosomal RNA1121936095121936219Rat
40929172LOC120099842uncharacterized LOC1200998421119297968119315737Rat
40957095Rpl7a-ps34ribosomal protein L7a, pseudogene 341117339434117347725Rat
41002066LOC120099839uncharacterized LOC1200998391118747408118781774Rat
40958364LOC120100454U2 spliceosomal RNA1133230750133230898Rat
40982950LOC120100285small nucleolar RNA SNORD1151110238704110238780Rat
40983394LOC120100261small nucleolar RNA SNORD1151110271033110271110Rat
40983475LOC120100257small nucleolar RNA SNORD1151110287232110287309Rat
40983518LOC120100263small nucleolar RNA SNORD1151110236867110236944Rat
41003782LOC120099862uncharacterized LOC1200998621132785368132793311Rat
40933693Trnap-gggtransfer RNA proline (anticodon GGG)19606763996067719Rat
41004471LOC120097182uncharacterized LOC12009718219602475096033425Rat
40935431LOC120099815uncharacterized LOC1200998151101354768101380898Rat
41008579LOC120097338uncharacterized LOC1200973381118247652118262726Rat
40938955LOC120100316small nucleolar RNA SNORD1161111000373111000465Rat
40939292LOC120100115U4 spliceosomal RNA19955785499557970Rat
40964065LOC120099806uncharacterized LOC12009980619689199996904056Rat
40964929LOC120100151U6 spliceosomal RNA1103004250103004356Rat
40990384Rnu6-658RNA, U6 small nuclear 65819361098493611083Rat
40966335LOC120100251small nucleolar RNA SNORD1151110258920110258997Rat
40941743LOC120100286small nucleolar RNA SNORD1151110311820110311899Rat
40942253LOC120099791uncharacterized LOC12009979118696272486966447Rat
40943119LOC120100274small nucleolar RNA SNORD1151110242382110242458Rat
40994046LOC120099799uncharacterized LOC12009979919387125693874563Rat
40943754LOC120100307small nucleolar RNA SNORD1161110987576110987668Rat
40943837LOC120100279small nucleolar RNA SNORD1151110305181110305258Rat
40943897LOC120100268small nucleolar RNA SNORD1151110212636110212713Rat
41047128LOC120099826uncharacterized LOC1200998261113454803113493548Rat
41074683LOC120099813uncharacterized LOC12009981319769140697706639Rat
41312538Atp5mpl-ps1ATP synthase membrane subunit 6.8PL, pseudogene 11133428752133429328Rat
41024969LOC120099847uncharacterized LOC1200998471122285441122312506Rat
41048269LOC120099818uncharacterized LOC1200998181103031956103034632Rat
41313338LOC120100411small nucleolar RNA SNORA1718757426087574391Rat
41049276Trnap-agg45transfer RNA proline (anticodon AGG) 4519541589095415964Rat
41077517LOC120099851uncharacterized LOC1200998511124972989125042272Rat
41077533LOC120100327small nucleolar RNA SNORD1161110490401110490493Rat
41050960LOC120099861uncharacterized LOC1200998611132181245132187438Rat
41079516LOC120100288small nucleolar RNA SNORD1151110189568110189645Rat
41247311LOC120100287small nucleolar RNA SNORD1151110313740110313816Rat
41247581LOC120099863uncharacterized LOC1200998631132800647132808007Rat
41248172Klk5l-ps2kallikrein related-peptidase 5 like, pseudogene 219460846594612477Rat
41029545LOC120099819uncharacterized LOC1200998191105731072105743435Rat
41248427LOC120099831uncharacterized LOC1200998311114615464114620387Rat
41255323Trnap-agg47transfer RNA proline (anticodon AGG) 471118957548118957629Rat
41332531LOC120100477small nucleolar RNA SNORA1118675870286758828Rat
41332605Snord33small nucleolar RNA, C/D box 3319561069995610783Rat
41054606Snord107small nucleolar RNA, C/D box 1071111099306111099377Rat
41143699LOC120099855uncharacterized LOC1200998551127368228127374172Rat
41143867LOC120099848uncharacterized LOC1200998481122441489122510976Rat
41338037LOC120100255small nucleolar RNA SNORD1151110294577110294654Rat
41338298LOC120100260small nucleolar RNA SNORD1151110227613110227690Rat
41257043Actg1-ps11actin, gamma 1, pseudogene 111128530958128550705Rat
41335386LOC120100237small nucleolar RNA SNORD1151110289065110289142Rat
41153489LOC120100164U6 spliceosomal RNA1105964547105964651Rat
41297869LOC120100284small nucleolar RNA SNORD1151110186394110186471Rat
41317864LOC120100248small nucleolar RNA SNORD1151110253404110253481Rat
41298225LOC120093062mas-related G-protein coupled receptor member B8-like19805785298058838Rat
41033562LOC120100264small nucleolar RNA SNORD1151110180033110180111Rat
41034538Trnap-agg55transfer RNA proline (anticodon AGG) 551120030751120030832Rat
41060898LOC120099814uncharacterized LOC1200998141101052794101087616Rat
41224851LOC120100335small nucleolar RNA SNORD1161110992583110992674Rat
41337281LOC120100320small nucleolar RNA SNORD1161111014871111014964Rat
41061314LOC120100421small nucleolar RNA SNORA171109086517109086648Rat
41226711LOC120099840uncharacterized LOC1200998401118932104118936851Rat
41235310LOC120100314small nucleolar RNA SNORD1161110477332110477424Rat
41303197LOC120100243small nucleolar RNA SNORD1151110246052110246129Rat
41303997LOC120099860uncharacterized LOC1200998601131469335131484623Rat
41016316LOC120100236small nucleolar RNA SNORD1151110283559110283636Rat
41039507LOC120100209U7 small nuclear RNA19086153790861598Rat
41064894LOC120100295small nucleolar RNA SNORD1161110498125110498217Rat
41236265LOC120100246small nucleolar RNA SNORD1151110249730110249807Rat
41236487Dnajb6-ps3DnaJ heat shock protein family (Hsp40) member B6, pseudogene 31102565949102567063Rat
41304089LOC120100239small nucleolar RNA SNORD1151110272865110272942Rat
41041613Rnu6-856RNA, U6 small nuclear 85619119747691197582Rat
41237530LOC120100125U6 spliceosomal RNA1124419603124419709Rat
41042878LOC120100262small nucleolar RNA SNORD1151110190139110190216Rat
41068534LOC120099869uncharacterized LOC1200998691133590983133598028Rat
41069108LOC120097222uncharacterized LOC12009722219982886399830975Rat
41239287LOC120099830uncharacterized LOC1200998301114155536114162109Rat
41021046LOC120099790uncharacterized LOC12009979018694152386954785Rat
41241885LOC120100156U1 spliceosomal RNA1128006617128006780Rat
41309315LOC120100235small nucleolar RNA SNORD1151110274700110274777Rat
41022847LOC120099833uncharacterized LOC1200998331115011988115017347Rat
41023737LOC120100319small nucleolar RNA SNORD1161110467179110467271Rat
155630625LOC127212837Sec61 pseudogene19275253692752936Rat
329845492LOC130062809uncharacterized LOC13006280919390078493913081Rat

Nucleotide Sequences
GenBank Nucleotide AU025840 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH612569.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631688Hcas2Hepatocarcinoma susceptibility QTL 230.0001liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)15925874115540829Rat
1578649Bmd8Bone mineral density QTL 84.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)14939317294393172Rat
1582234Gluco18Glucose level QTL 183.40.0003blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)178479925123479925Rat
61442Strs1Sensitivity to stroke QTL 17.4cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)1121767634166767634Rat
1358359Sradr1Stress Responsive Adrenal Weight QTL 14.74adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)130882023123479925Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
1578654Bss10Bone structure and strength QTL 104femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)149393172159356837Rat
1554320Bmd1Bone mineral density QTL 112.20.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)150910886060548Rat
2300324Fetw1Fetal weight QTL 112.10.005fetal growth trait (VT:0004201)fetal body weight (CMO:0002080)185424647100358001Rat
1300121Hrtrt1Heart rate QTL 13.7heart pumping trait (VT:2000009)heart rate (CMO:0000002)165789093115540829Rat
1598866Bp287Blood pressure QTL 2875.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121006655166006655Rat
1578770Stresp23Stress response QTL 23kidney sympathetic nerve activity (VT:0004050)stimulated renal sympathetic nerve activity to basal renal sympathetic nerve activity ratio (CMO:0001786)1123350408182418476Rat
9590300Scort16Serum corticosterone level QTL 164.390.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1103111621148111621Rat
2298545Neuinf8Neuroinflammation QTL 84.6nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)157336763151090257Rat
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1115540693238914717Rat
631199Cm23Cardiac mass QTL 234.60.0004heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1115585465172949803Rat
1302788Scl19Serum cholesterol QTL 194.60.001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)190532338123479925Rat
631569Bp93Blood pressure QTL 930.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1106047847121834139Rat
2313402Anxrr24Anxiety related response QTL 24aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)148963584144267916Rat
1598850Bp297Blood pressure QTL 2972.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121006655166006655Rat
631570Bp94Blood pressure QTL 940.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123479780142990467Rat
61342Bp27Blood pressure QTL 273.40.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)15673266898773277Rat
61344Bp29Blood pressure QTL 297.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)178350581123350581Rat
724521Uae1Urinary albumin excretion QTL 13.80.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)190508614173018436Rat
1358902Bw47Body weight QTL 471.67body mass (VT:0001259)body weight (CMO:0000012)190508614180359386Rat
61346Rf2Renal disease susceptibility QTL 23.7urine protein amount (VT:0005160)urine protein level (CMO:0000591)199267916144267916Rat
2313094Bss58Bone structure and strength QTL 583.70.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143284731118944897Rat
8655649Arrd1Age-related retinal degeneration QTL 14.89retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1100357752183970443Rat
2300164Bmd44Bone mineral density QTL 445.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)156949932101949932Rat
2313099Bss56Bone structure and strength QTL 562.40.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143284731118944897Rat
2313098Bmd70Bone mineral density QTL 703.60.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)143284731118944897Rat
1300153Bp171Blood pressure QTL 1713.37arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)190664883143200202Rat
2317833Alcrsp19Alcohol response QTL 1912.40.001response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1100979852145979852Rat
731168Bp154Blood pressure QTL 1543.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194642644214537671Rat
631202Gluco13Glucose level QTL 130.0001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1131763437159756369Rat
631205Bp196Blood pressure QTL 19640.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118944897199050459Rat
1300158Bp173Blood pressure QTL 1733.48arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)1115540693185145286Rat
1641897Alcrsp1Alcohol response QTL 1response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1100979852145979852Rat
1331749Hrtrt11Heart rate QTL 112.973heart pumping trait (VT:2000009)heart rate (CMO:0000002)194494440198211706Rat
1331751Bp199Blood pressure QTL 1993.60022arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)194494440181830018Rat
2293142Bp314Blood pressure QTL 314arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)192184926137184926Rat
9685799Bp375Blood pressure QTL 375arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501170611501Rat
2293140Bp313Blood pressure QTL 313arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121833674166833674Rat
9685802Bp376Blood pressure QTL 376arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1126540680171540680Rat
724529Cm16Cardiac mass QTL 162.7heart mass (VT:0007028)calculated heart weight (CMO:0000073)187580395150700247Rat
61370Mcs3Mammary carcinoma susceptibility QTL 32.15mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1102268556147268556Rat
1641895Bp298Blood pressure QTL 298arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1123350408182418476Rat
2313059Bss55Bone structure and strength QTL 553.20.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
70209Niddm23Non-insulin dependent diabetes mellitus QTL 232.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)194494440198324465Rat
631496Bp97Blood pressure QTL 973.08arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1106047847151047847Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149393289199050459Rat
2303591Gluco41Glucose level QTL 412blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1102168504147168504Rat
1331793Bp200Blood pressure QTL 2003.71601arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194494440172949803Rat
2313060Bss71Bone structure and strength QTL 712.60.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)1118944747163944747Rat
2302059Pia36Pristane induced arthritis QTL 363.80.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)14333300288333002Rat
6893347Bw98Body weight QTL 980.20.53body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
1354591Cm36Cardiac mass QTL 364.1heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1102813953201278233Rat
1331800Scl25Serum cholesterol level QTL 253.013blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)194494440117601394Rat
7421628Bp361Blood pressure QTL 3610.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)166023617118608521Rat
631495Bp96Blood pressure QTL 964.52arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)122340647102268831Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118608292241799120Rat
70225Bp58Blood pressure QTL 583.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132356093162846471Rat
631512Scl6Serum cholesterol level QTL 69.6blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)17219768090508767Rat
2313072Bss53Bone structure and strength QTL 534.30.0001tibia length (VT:0004357)tibia length (CMO:0000450)143284731118944897Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132737458199368955Rat
2313078Bss54Bone structure and strength QTL 543.50.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
61399Tcat1Tongue tumor resistance QTL 13.3tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 5 mm (CMO:0001879)199267916144267916Rat
1549903Bp267Blood pressure QTL 267arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)177876254106047988Rat
2313083Bmd74Bone mineral density QTL 7440.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)182174743118944897Rat
6893361Bw104Body weight QTL 1040.590.27body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
4889494Scort2Serum corticosterone level QTL 24.2blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)180592172125592172Rat
724567Tcas6Tongue tumor susceptibility QTL 66.85tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)192948896144267916Rat
738006Anxrr14Anxiety related response QTL 1440.00035locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1130636910175636910Rat
1300172Bp172Blood pressure QTL 1723.56arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)13273727390665040Rat
1558645Bw55Body weight QTL 553.20.004body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
1354615Cm32Cardiac mass QTL 325.2heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1102813953201278233Rat
1358192Ept13Estrogen-induced pituitary tumorigenesis QTL 133.4pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)177494165122494165Rat
6903308Scl36Serum cholesterol QTL 3620.0125blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)15386304190532583Rat
634348Bp138Blood pressure QTL 138arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501168883176Rat
8694370Bw154Body weight QTL 1548.910.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)1103111621148111621Rat
738028Anxrr12Anxiety related response QTL 124.90.00001locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1130636910175636910Rat
1354623Rf46Renal function QTL 463.8blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)1102813953151162766Rat
738022Anxrr13Anxiety related response QTL 134.60.00039locomotor behavior trait (VT:0001392)number of 20 x 20 cm floor squares crossed into, out of or within a discrete space in an experimental apparatus (CMO:0001514)183547917128547917Rat
10054135Gmadr2Adrenal mass QTL 21.970.0129adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)177857876122857876Rat
631654Bp107Blood pressure QTL 107arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501170611501Rat
7411712Strs4Sensitivity to stroke QTL 48.7cerebrum integrity trait (VT:0010549)percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932)178430536123430536Rat
631544Bp84Blood pressure QTL 845.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350408181759564Rat
631549Bp89Blood pressure QTL 895.7arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350581201284552Rat
2313051Bss57Bone structure and strength QTL 573.70.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)143284731118944897Rat
61433Cia2Collagen induced arthritis QTL 25joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)17843075491209302Rat
1358189Cstrr1Cold stress response QTL 10.0001catecholamine amount (VT:0010543)urine norepinephrine level (CMO:0001629)1123350408182418476Rat
1354606Bp246Blood pressure QTL 2463.6arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)1102813953218753816Rat
2325726Eae30Experimental allergic encephalomyelitis QTL 30nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)1123053310128593844Rat


Additional Information

Database Acc Id Source(s)
UniSTS 114868 UniSTS