D9Rat157 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: D9Rat157

Symbol:

D9Rat157

Previously known as:

oxsts11675; R0221-B05;

RGD ID:

42885

Expected Size:

165 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
GRCr8	9	44,918,012 - 44,918,177 (+)	Marker Load Pipeline
mRatBN7.2	9	37,422,134 - 37,422,299 (+)	MAPPER	mRatBN7.2
Rnor_6.0	9	41,708,830 - 41,708,994	NCBI	Rnor6.0
Rnor_5.0	9	41,379,348 - 41,379,512	UniSTS	Rnor5.0
RGSC_v3.4	9	33,913,434 - 33,913,599	RGD	RGSC3.4
RGSC_v3.4	9	33,913,435 - 33,913,599	UniSTS	RGSC3.4
Celera	9	35,201,198 - 35,201,364	UniSTS
RGSC_v3.1	9	33,914,708 - 33,915,211	RGD
RH 2.0 Map	9	356.4	RGD
SHRSP x BN Map	9	33.1798	RGD

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	Rat Genetic Map Data	Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3.	Electronic Transfer of SSLP Data	Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4.	UniSTS Pipeline	RGD automated pipelines
5.	RH Map Project	RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
6.	A high density integrated genetic linkage and radiation hybrid map of the laboratory rat	Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence


Forward Primer	GCCATGTATTACATTGCACTCTC
Reverse Primer	CATCAGAGAAGGGGCTGAAG

Template	GCATGCTGCAGGTCGACTCTAGAGGATCCCCCCAGGGTGTTTGTTTATAACCTTGACTTTTACT GTATCAGCATCCCCTTTTTAAATCCCTAAATATAAACCATGCCTCTCATAAAGCGACTTTTAAT TTCACCCACAAAAGGAAATCCTGTAAGAAAAATAAGGAGACATACAATTTTTGCTTAAGTTTTA GATTTTAAGATTTAGTCTTTGCTTAATCTTTTAGCCATGTATTACATTGCACTCTCTGAATAAT GTAACTTAGAAAAATCCACAAAATTGTATATGTGTGTGCAAACACACACACACACACACACACA CACACACACACACACACACACACCACAGCAATGAGAATAACTTCAGCCCCTTCTCTGATGGAAG GATTCTANTGTGACTGACTTACCCTCAGGCAGCTGGCTGGCTACCAGAGGGAATGGTGTCTCTC ATTGGTGGTGCAGCTGGGCTCTGCTGCTGACAGANTGCATGCACACTTAGCCTCACTGCAGTCA GACAGGGGGTACGAGNC

Region

Nucleotide Sequences


GenBank Nucleotide	JH616760.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (GRCr8)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
2303170	Bp332	Blood pressure QTL 332	3.73	0.027	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	9	6714888	84474983	Rat
631211	Bw4	Body weight QTL4	5.31		retroperitoneal fat pad mass (VT:0010430)	retroperitoneal fat pad weight to body weight ratio (CMO:0000635)	9	5346479	50346479	Rat
7411571	Bw138	Body weight QTL 138	14.3	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	9	40029925	85029925	Rat
2303559	Gluco54	Glucose level QTL 54	2		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	9	8750492	53750492	Rat
1300180	Bw14	Body weight QTL 14	3.776		body mass (VT:0001259)	body weight (CMO:0000012)	9	31250432	68875676	Rat
8662828	Vetf6	Vascular elastic tissue fragility QTL 6	3.9		artery integrity trait (VT:0010639)	patent ductus arteriosus score (CMO:0002566)	9	44458256	99506504	Rat
61450	Ciaa3	CIA Autoantibody QTL 3	6.5		blood autoantibody amount (VT:0003725)	calculated serum anti-type 2 collagen antibody titer (CMO:0001279)	9	29567664	74567664	Rat
1598834	Memor11	Memory QTL 11	2.5		exploratory behavior trait (VT:0010471)	average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)	9	44458256	85262605	Rat
70186	Niddm26	Non-insulin dependent diabetes mellitus QTL 26	3.87		blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	9	29567664	83835942	Rat
70218	Cm28	Cardiac mass QTL 28	8.3	0.0001	heart mass (VT:0007028)	heart wet weight (CMO:0000069)	9	41720295	86720295	Rat
9589055	Scfw5	Subcutaneous fat weight QTL 5	5.55	0.001	subcutaneous adipose mass (VT:1000472)	abdominal subcutaneous fat pad weight (CMO:0002069)	9	496645	45496645	Rat
1641911	Alcrsp13	Alcohol response QTL 13			response to alcohol trait (VT:0010489)	brain neurotensin receptor 1 density (CMO:0002068)	9	6214995	51214995	Rat
1354650	Despr5	Despair related QTL 5	4.01	0.0017	locomotor behavior trait (VT:0001392)	amount of time spent in voluntary immobility (CMO:0001043)	9	8750492	53750492	Rat
7207805	Bmd88	Bone mineral density QTL 88	4		femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	9	31250432	65651574	Rat
2290450	Scl57	Serum cholesterol level QTL 57	4.15		blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	9	44458256	121768150	Rat
61425	Cia15	Collagen induced arthritis QTL 15	4.6		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	9	5346479	50416711	Rat
9589158	Gluco65	Glucose level QTL 65	6.82	0.001	blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	9	496645	45496645	Rat
1600365	Mcs20	Mammary carcinoma susceptibility QTL 20	3		mammary gland integrity trait (VT:0010552)	mammary tumor growth rate (CMO:0000344)	9	21031430	49025574	Rat
1581517	Bp284	Blood pressure QTL 284			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	9	39220186	84220186	Rat
7411592	Foco8	Food consumption QTL 8	7.4	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	9	496645	45496645	Rat
7411656	Foco26	Food consumption QTL 26	9.8	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	9	40029925	85029925	Rat
1298088	Edpm11	Estrogen-dependent pituitary mass QTL 11	2.5		pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	9	6214995	51214995	Rat
1598823	Memor16	Memory QTL 16	1.9		exploratory behavior trait (VT:0010471)	difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)	9	31456061	57460683	Rat
1641894	Alcrsp12	Alcohol response QTL 12			response to alcohol trait (VT:0010489)	brain neurotensin receptor 1 density (CMO:0002068)	9	34960590	79960590	Rat

Additional Information

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D9Rat157