D4Arb30 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D4Arb30

Symbol: D4Arb30
Also known as: R0266-C03; oxsts7887; 
RGD ID: 42168
Expected Size: 205 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
RGSC_v3.4473,972,454 - 73,972,591UniSTSRGSC3.4
RGSC_v3.4473,972,453 - 73,972,591RGDRGSC3.4
RGSC_v3.1474,248,583 - 74,248,721RGD
Celera469,789,851 - 69,789,980UniSTS
RH 3.4 Map4465.4RGD
RH 3.4 Map4465.4UniSTS
RH 2.0 Map4512.0RGD
SHRSP x BN Map437.38RGD
FHH x ACI Map445.77RGD
Cytogenetic Map4q24UniSTS
Is Marker For: Strains:   DA.F344-(D4Arb30-D4Arb4)/Arb  
QTLs:   Scwia1   Aia2   Aia3  
Genes:   Cntnap2   LOC100364190  


Annotation



Strains and Sequence

Sequence
 
Forward Primer ACTACCATAGAAAATGCTGG
Reverse Primer GATCCACTGCTCAAACACAT
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473959 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000234 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100364190 UniSTS
  326415 UniSTS
  326477 UniSTS
  326478 UniSTS
  500105 UniSTS
UniSTS 121913 UniSTS