D11Rat79 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D11Rat79

Symbol: D11Rat79
Previously known as: R0221-A08; oxsts9304; 
RGD ID: 41242
Expected Size: 156 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21113,528,632 - 13,528,786 (+)MAPPERmRatBN7.2
Rnor_6.01112,079,127 - 12,079,280NCBIRnor6.0
Rnor_5.01115,744,167 - 15,744,320UniSTSRnor5.0
RGSC_v3.41113,667,083 - 13,667,237RGDRGSC3.4
RGSC_v3.41113,667,084 - 13,667,237UniSTSRGSC3.4
RGSC_v3.11113,667,083 - 13,667,237RGD
Celera1113,548,035 - 13,548,189UniSTS
RH 2.0 Map11657.3RGD
SHRSP x BN Map112.5099RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  


Annotation



Strains and Sequence

Sequence
 
Forward Primer TCCTGTGGCTTTTTGTAGGC
Reverse Primer GGCAGACCTAACACTGAGGC
 
Template
GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCTCAATATTACTCATTTCTGCAGTGTAA
ATATAAAATAACCTGAAAAGTTATTTAATGAATAATGAACAGATTTTGGTGTTTGAATAAAAAT
GTAGCCATTCGTTAAAAAGAAATATGACTTAGAATAAAGAAAAGAACATGAGAGAGGCAGACCT
AACACTGAGGCTGTGTGAAAACAACATCTGAAAATCTGCACGTGCACGCATGTGGCGCGCGCCA
CACACACACACACACACACACACACACACACACACACACACATTAGTTTTTAGACACAGATATG
CCTACAAAAAGCCACAGGACTTTAAATAAAAAGGGGTACCGAGCTCGAATTCGTAATCATGGTC
ATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGC
ATAAAGTGTAAGCCTGGGGTGCTAATGAGTGAGTNCTCACATTATTGCGTTGGCCATGCCGCTT
NNGTCGGGAACTGNNGGCCCNNNNTTTATTANNGCCNCGGCGGGAGNNGGTNNNTATGGCCNNG
NGTTTCTNTC

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
620167Robo2roundabout guidance receptor 2111252894914096726Rat

Nucleotide Sequences
GenBank Nucleotide CH473989 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000241 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
634341Bw121Body weight QTL 1213.56abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)11121836709Rat
1598842Glom10Glomerulus QTL 103.4kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)11135331169Rat
1300147Bp187Blood pressure QTL 1873.67arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)11169446234Rat
1558659Tescar1Testicular tumor resistance QTL 13.9testis integrity trait (VT:0010572)percentage of study population developing testis tumors during a period of time (CMO:0001261)11104193166113562Rat
1641927Alcrsp10Alcohol response QTL 10alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)11843667453436674Rat
2290451Scl58Serum cholesterol level QTL 583.48blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)111283104625121472Rat


Additional Information

Database Acc Id Source(s)
UniSTS 120794 UniSTS