D10Rat134 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D10Rat134

Symbol: D10Rat134
Previously known as: oxsts8668; R0108-A06; 
RGD ID: 41042
Expected Size: 207 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.210103,784,905 - 103,785,112 (+)MAPPERmRatBN7.2
Rnor_6.010107,579,840 - 107,580,046NCBIRnor6.0
Rnor_5.010107,214,772 - 107,214,978UniSTSRnor5.0
RGSC_v3.410108,557,381 - 108,557,588RGDRGSC3.4
RGSC_v3.410108,557,382 - 108,557,588UniSTSRGSC3.4
RGSC_v3.110108,571,885 - 108,572,092RGD
Celera10102,344,864 - 102,345,070UniSTS
SHRSP x BN Map1092.75RGD
SHRSP x BN Map1092.75UniSTS
Cytogenetic Map10q32.3UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Bw87  
Genes:   Rbfox3  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCTGCCAAGGGTTAACTGCT
Reverse Primer CTACCGGCTCTCTGTGGAAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1560070Rbfox3RNA binding fox-1 homolog 310103720355104157277Rat

Nucleotide Sequences
GenBank Nucleotide CH473948 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000240 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2303118Mamtr7Mammary tumor resistance QTL 70.003mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)109658275104670812Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014487011104060283Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014487011107057807Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)1029299504107211142Rat
631269Cia22Collagen induced arthritis QTL 228.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
631270Cia23Collagen induced arthritis QTL 233.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
1298078Stresp5Stress response QTL 52.990.00025blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1042045676104670812Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1051770177107211142Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1051770177107211142Rat
70171Cari1Carrageenan-induced inflammation QTL 14.90.0005hypodermis integrity trait (VT:0010550)inflammatory exudate volume (CMO:0001429)1053797385107211142Rat
2293698Bss43Bone structure and strength QTL 435.330.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1059209888104209888Rat
2313103Bss80Bone structure and strength QTL 8020.0001tibia strength trait (VT:1000284)tibia midshaft endosteal cross-sectional area (CMO:0001716)1062057807107057807Rat
2313105Bss79Bone structure and strength QTL 791.80.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)1062057807107057807Rat
61449Ciaa2CIA Autoantibody QTL 27.1blood autoantibody amount (VT:0003725)calculated serum anti-type 2 collagen antibody titer (CMO:0001279)1063221094107211142Rat
2317029Aia19Adjuvant induced arthritis QTL 192.98joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)1066978955107211142Rat
2317039Aia6Adjuvant induced arthritis QTL 64.31joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)1066978955107211142Rat
10450498Bp384Blood pressure QTL 3840.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1067750049107211142Rat
1642980Bp300Blood pressure QTL 300arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1068383129107211142Rat
61396Bp9Blood pressure QTL 94.80.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1068420376107211142Rat
2300172Bmd57Bone mineral density QTL 579.80.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1069738412107211142Rat
2293646Bss25Bone structure and strength QTL 2510.960.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1069738412107211142Rat
2293663Bss33Bone structure and strength QTL 339.340.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1069738412107211142Rat
6893366Bw106Body weight QTL 1060.30.47body mass (VT:0001259)body weight (CMO:0000012)1070199100107211142Rat
70193Mcs7Mammary carcinoma susceptibility QTL 72.38mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1072224939107211142Rat
2298548Neuinf7Neuroinflammation QTL 73.4nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)1072224939107211142Rat
2292438Bp311Blood pressure QTL 311arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1076246085107211142Rat
1302404Cia27Collagen induced arthritis QTL 272.60.0045joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)1076452683107211142Rat
4889492Pancm2Pancreatic morphology QTL 23.2pancreatic beta cell morphology trait (VT:0005217)ratio of insulin-positive cell area to total area of splenic region of pancreas (CMO:0001814)1076748906107211142Rat
2303589Bw87Body weight QTL 872body mass (VT:0001259)body weight (CMO:0000012)1081285008107211142Rat
2317754Glom25Glomerulus QTL 253.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)1082685200107211142Rat
1600367Mcs15Mammary carcinoma susceptibility QTL 154.5mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1085565469103884409Rat
631538Oia5Oil induced arthritis QTL 5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1087055121107211142Rat
61363Oia3Oil induced arthritis QTL 30.001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1087307617107211142Rat
634320Niddm49Non-insulin dependent diabetes mellitus QTL 494.41blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1088539139107211142Rat
12880395Cm109Cardiac mass QTL 1090.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)1090404397107211142Rat
12880396Am13Aortic mass QTL 130.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)1090404397107211142Rat
12880398Kidm67Kidney mass QTL 670.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1090404397107211142Rat
12880384Cm107Cardiac mass QTL 1070.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)90404397107211142Rat
12880385Cm108Cardiac mass QTL 1080.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)90404397107211142Rat
1579915Bp280Blood pressure QTL 2800.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1090404397107211142Rat
1300137Bp186Blood pressure QTL 1863.57arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)1090627439107057807Rat
724530Bp149Blood pressure QTL 1490.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1090627439107211142Rat
1558652Bw57Body weight QTL 574.20.0008body mass (VT:0001259)body weight (CMO:0000012)1090910316107211142Rat
61436Cia5Collagen induced arthritis QTL 54.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1091228102104060283Rat
1354641Bvd2Brain ventricular dilatation QTL 26.360.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)1093223816107057807Rat
10450493Bp382Blood pressure QTL 3820.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1094759759107211142Rat
2292436Bp310Blood pressure QTL 310arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1094759759107211142Rat
1576307Cia28Collagen induced arthritis QTL 28joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1096120911104060283Rat
1576313Pia25Pristane induced arthritis QTL 25joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1096120911104060283Rat
1578663Bss18Bone structure and strength QTL 183.6femur width (VT:1000666)femoral neck width (CMO:0001695)1096703043107057807Rat
1578672Bmd16Bone mineral density QTL 166.2femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)1096703043107057807Rat
631539Oia6Oil induced arthritis QTL 6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1097010147104670812Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100303629 UniSTS
  287847 UniSTS
UniSTS 226282 UniSTS