D2Rat278 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D2Rat278

Symbol: D2Rat278
Previously known as: oxsts10538; R0262-A04; 
RGD ID: 40612
Expected Size: 116 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr82104,020,445 - 104,020,561 (+)Marker Load Pipeline
mRatBN7.22102,104,314 - 102,104,430 (+)MAPPERmRatBN7.2
mRatBN7.22102,104,121 - 102,104,430 (+)MAPPERmRatBN7.2
Rnor_6.02104,421,261 - 104,421,376NCBIRnor6.0
Rnor_6.02104,421,037 - 104,421,376NCBIRnor6.0
Rnor_5.02124,144,350 - 124,144,465UniSTSRnor5.0
Rnor_5.02124,144,126 - 124,144,465UniSTSRnor5.0
RGSC_v3.42104,725,478 - 104,725,593UniSTSRGSC3.4
RGSC_v3.42104,725,477 - 104,725,593RGDRGSC3.4
Celera297,498,066 - 97,498,185UniSTS
RGSC_v3.12104,670,439 - 104,670,555RGD
SHRSP x BN Map236.5198RGD
SHRSP x BN Map236.5198UniSTS
FHH x ACI Map248.8399RGD
Cytogenetic Map2q24UniSTS
Is Marker For: Strains:   NEDH/K   NP9   ODU/N   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SR/Jr   SHRSP/Riv   SS/Jr   WAG/RijKyo   WF/Pit   WIST/Nhg   WKY/OlaHsd   WTC/Kyo   ACI/N   AVN/Orl   BBDR/Rhw   BBDP/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN-Lx/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   COP/OlaHsd   DA/PitN   FHH/Eur   F344/Pit   GH/Omr   GK/KyoSwe   DON/Melb   M520/N   IS/Kyo   WN/N   LH/Mav   LE/Mol   LEW/Pit   LOU/CHan   LN/Mav   MHS/Gib   MNR/N   MNRA/N   MNS/Gib   MR/Pit  
Genes:   Trim55  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCCCAAAGAATCTCTGAGGTG
Reverse Primer CACGTGAACATGCAGTCATG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1306943Trim55tripartite motif-containing 552104016361104058302Rat

Nucleotide Sequences
GenBank Nucleotide CH473961 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000232 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1578777Stresp15Stress response QTL 1520.05blood aldosterone amount (VT:0005346)plasma aldosterone level (CMO:0000551)261556902106556902Rat
1298074Bp164Blood pressure QTL 1640.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)244537979205135428Rat
1598865Bp296Blood pressure QTL 2962.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)282947902127947902Rat
1354648Bp239Blood pressure QTL 2390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)267845370229470703Rat
1578772Stresp14Stress response QTL 1450.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)284056790132859658Rat
1354649Kidm17Kidney mass QTL 172.9kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)283465462229820014Rat
10755499Bp389Blood pressure QTL 3892.61arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)220695736231474293Rat
1581576Pur7Proteinuria QTL 70.0001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)280396178220931218Rat
152025242Bw191Body weight QTL 1913.62body mass (VT:0001259)240306867124537199Rat
631198Cm22Cardiac mass QTL 224.30.0008heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)278269809208420281Rat
1302794Stl27Serum triglyceride level QTL 274.40.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)227148328145807373Rat
61465Bp13Blood pressure QTL 133.3blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)278269809104744824Rat
1581569Uae32Urinary albumin excretion QTL 320.0001urine protein amount (VT:0005160)urine albumin excretion rate (CMO:0000757)280396178220931218Rat
2317886Alcrsp23Alcohol response QTL 232.40.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)295142371140142371Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)241801363104744824Rat
1358901Cm38Cardiac mass QTL 382heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)227148328159440891Rat
2317058Aia13Adjuvant induced arthritis QTL 132.9joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)278269809123269809Rat
1331760Bp206Blood pressure QTL 2063.62454arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)24265106205135428Rat
1358899Kidm23Kidney mass QTL 233.88kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)227148328159440891Rat
1358908Bw49Body weight QTL 493.36body mass (VT:0001259)body weight (CMO:0000012)227148557159440760Rat
1300155Bp174Blood pressure QTL 1744.09arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)244537979112567334Rat
5684990Bmd82Bone mineral density QTL 822.8tibia mineral mass (VT:1000283)bone mineral content (CMO:0001554)261051541105724065Rat
1358910Kidm27Kidney mass QTL 275.77kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)227148328159440891Rat
61355Bp36Blood pressure QTL 362.9blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)27605533104774005Rat
1358911Kidm28Kidney mass QTL 285.42kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)227148328159440891Rat
1358904Cm39Cardiac mass QTL 392.26heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)227148328159440891Rat
1359035Bp276Blood pressure QTL 276arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2100807373145807373Rat
1358887Bw50Body weight QTL 502.39body mass (VT:0001259)body weight (CMO:0000012)227148557159440760Rat
1298080Bp163Blood pressure QTL 1630.02arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)267845182205135428Rat
8662832Vetf7Vascular elastic tissue fragility QTL 73.5aorta elastin amount (VT:0003905)aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)283400752223709938Rat
1298085Bp165Blood pressure QTL 1650.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)244537979205135428Rat
2290453Scl55Serum cholesterol level QTL 552.83blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)228652666139067443Rat
2299162Iddm32Insulin dependent diabetes mellitus QTL 322.36blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)293602631145807373Rat
1358894Kidm24Kidney mass QTL 244.03kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)227148328159440891Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)280396034220931416Rat
61374Edpm2Estrogen-dependent pituitary mass QTL 24.420.86pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)278269809205135428Rat
631500Bp99Blood pressure QTL 992.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)261051883104684275Rat
61392Bp6Blood pressure QTL 67arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)282214549127214549Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)227148328206613235Rat
5684996Bmd85Bone mineral density QTL 854.70.024tibia mineral mass (VT:1000283)bone mineral density (CMO:0001226)261051541105724065Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)227148328206613235Rat
2293835Kiddil5Kidney dilation QTL 53.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)244537979159440891Rat
1354622Kidm16Kidney mass QTL 163kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)283465462225110681Rat
631266Bp132Blood pressure QTL 1320.0005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)247856345205135428Rat
1558648Smcn1Smooth muscle cell number QTL 10.039blood vessel smooth muscle cell quantity (VT:0010525)aorta smooth muscle cell count per unit vessel length (CMO:0001646)260861391105861391Rat
2293843Kiddil6Kidney dilation QTL 63.1kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)244537979184731399Rat
2306903Bp336Blood pressure QTL 3360.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)238426449111295694Rat
152025206Hrtrt23Heart rate QTL 235.98heart pumping trait (VT:2000009)230219200171802126Rat
1354605Rf48Renal function QTL 482.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)276328396209350714Rat
152025204Hrtrt22Heart rate QTL 225.6heart pumping trait (VT:2000009)230219200171802126Rat
61438Cia7Collagen induced arthritis QTL 74.60.0001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)261051541143746880Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 365751 UniSTS