D18Rat45 Marker Search Result - Rat Genome Database

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

General

Marker: D18Rat45

Symbol:

D18Rat45

Previously known as:

R0083-C06; oxsts9968;

RGD ID:

39098

Expected Size:

131 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	18	74,055,619 - 74,055,742 (+)	MAPPER	mRatBN7.2
Rnor_6.0	18	77,212,212 - 77,212,332	NCBI	Rnor6.0
Rnor_5.0	18	76,318,595 - 76,318,715	UniSTS	Rnor5.0
RGSC_v3.4	18	77,510,855 - 77,510,975	UniSTS	RGSC3.4
RGSC_v3.4	18	77,510,828 - 77,511,190	RGD	RGSC3.4
RGSC_v3.1	18	77,584,128 - 77,584,248	RGD
Celera	18	72,713,123 - 72,713,243	UniSTS
RH 3.4 Map	18	794.7	RGD
RH 3.4 Map	18	794.7	UniSTS
RH 2.0 Map	18	106.0	RGD
SHRSP x BN Map	18	47.8399	RGD
FHH x ACI Map	18	58.5499	RGD
Cytogenetic Map	18	q12.3	UniSTS

Is Marker For:

Strains: AVN/Orl BBDP/Rhw BBDR/Rhw BC/CpbU BDIX/Han BDVII/Cub BN/SsNHsd BP/Cub BUF/Pit DA/PitN DON/Melb F344/Pit FHH/Eur IS/Kyo LE/Mol LEW/Pit LH/Mav MHS/Gib MNRA/N WN/N WKY/OlaHsd WTC/Kyo LOU/CHan MNR/N MR/Pit ODU/N WF/Pit WIST/Nhg SR/Jr MNS/Gib NP9 OKA/Wsl OM/Ztm P5C PVG/Pit SD/Rij SHR/OlaHsd SHRSP/Riv WAG/RijKyo GK/KyoSwe M520/N ACI/N BN-Lx/Cub LN/Mav GH/Omr NEDH/K SS/Jr COP/OlaHsd SS.LEW-(D18Chm41-D18Rat45)/Ayd SS.LEW-(D18Rat61-D18Rat45)/Ayd
Genes: RGD1560225 Nfatc1

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.	Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3.	Rat Genetic Map Data	Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4.	Electronic Transfer of SSLP Data	Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5.	UniSTS Pipeline	RGD automated pipelines
6.	RH Map Project	RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7.	A high density integrated genetic linkage and radiation hybrid map of the laboratory rat	Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence


Forward Primer	TTGGGCTTGGGTATGCTATC
Reverse Primer	ACCTGAAAAACCAACCATGG

Template	GCAGGTCGACTCTAGAGGATCCCCCCCCCTCCCCAGTGCGGTGGTATTCAACTGGCCTCTTAAC GTGCTTGGGTCACTGCTCTGCCTCAGACAGTCCCACCGAGAAAGAGGGACGAGTGGAACATGTG GGCATGTGGGTGGTCAGGTAGAGCTCTGCCAAACCACCATTTTCCCAGGTTGCTCAGATCTCAT GGCTGCATCTGATGAGAAAGAGCCTTACAACGCTAACCTTAGCACTGACCTGAAAAACCAACCA TGGATGTTTGCTCTGATAACCAACACACACACACACACACACACACACACACACACACACACAC ACACACACACACACTGCTAGGAACCTGGAGGATAGCATACCCAAGCCCAAGGGGAGGTCGCATG ACTTTGGGCGGGGTACCGAGCTCGAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATT GTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAANGTGTAAAGCCTGGGGTGC CTANTGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCANC

Strain Variation

Strain, Expected Size(s)

ACI/N	138
AVN/Orl	136
BBDP/Rhw	136
BBDR/Rhw	136
BC/CpbU	136
BDIX/Han	136
BDVII/Cub	136
BN-Lx/Cub	124
BN/SsNHsd	124
BP/Cub	136
BUF/Pit	128
COP/OlaHsd	136
DA/PitN	136

DON/Melb	131
F344/Pit	136
FHH/Eur	136
GH/Omr	136
GK/KyoSwe	136
IS/Kyo	128
LE/Mol	136
LEW/Pit	124
LH/Mav	128
LN/Mav	136
LOU/CHan	124
M520/N	136
MHS/Gib	124

MNR/N	138
MNRA/N	136
MNS/Gib	124
MR/Pit	136
NEDH/K	136
NP9	136
ODU/N	124
OKA/Wsl	130
OM/Ztm	136
P5C	136
PVG/Pit	136
SD/Rij	136
SHR/OlaHsd	130

SHRSP/Riv	130
SR/Jr	128
SS/Jr	136
WAG/RijKyo	124
WF/Pit	136
WIST/Nhg	136
WKY/OlaHsd	124
WN/N	116
WTC/Kyo	130

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
2319357	Nfatc1	nuclear factor of activated T-cells 1	18	74046422	74156041	Rat

Nucleotide Sequences


GenBank Nucleotide	JH619328.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1578661	Bss20	Bone structure and strength QTL 20	3.7		femur morphology trait (VT:0000559)	femoral neck cross-sectional area (CMO:0001697)	18	11791518	83218561	Rat
1578667	Bss21	Bone structure and strength QTL 21	3.5		femur morphology trait (VT:0000559)	femoral neck cortical cross-sectional area (CMO:0001702)	18	11791518	83218561	Rat
1600373	Mamtr6	Mammary tumor resistance QTL 6			mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	18	19278901	83218561	Rat
1331741	Bp232	Blood pressure QTL 232	3.59112		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	18	21372893	83213037	Rat
1331733	Bp233	Blood pressure QTL 233	3.97196		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	18	24796977	79788953	Rat
9589816	Gluco68	Glucose level QTL 68	7.25	0.001	blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	18	29792965	74792965	Rat
8694378	Bw157	Body weight QTL 157	3.59	0.001	body lean mass (VT:0010483)	lean tissue morphological measurement (CMO:0002184)	18	29792965	74792965	Rat
9590318	Scort22	Serum corticosterone level QTL 22	7.64	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	18	29792965	74792965	Rat
1331754	Bp230	Blood pressure QTL 230	4.61609		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	18	29792965	74792965	Rat
738005	Anxrr11	Anxiety related response QTL 11	3.4		exploratory behavior trait (VT:0010471)	number of entries into a discrete space in an experimental apparatus (CMO:0000960)	18	30039813	75039813	Rat
2303120	Mamtr8	Mammary tumor resistance QTL 8		0.001	mammary gland integrity trait (VT:0010552)	mammary tumor growth rate (CMO:0000344)	18	31359408	83218561	Rat
631274	Sprol1	Serum protein level QTL 1	5.3		blood total protein amount (VT:0005567)	serum total protein level (CMO:0000661)	18	31393320	77209694	Rat
631518	Bw11	Body weight QTL 11	2.8		body mass (VT:0001259)	body weight (CMO:0000012)	18	35870723	80870723	Rat
61367	Iddm4	Insulin dependent diabetes mellitus QTL 4	2.33	0.0074	blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	18	38192455	83192455	Rat
1598826	Anxrr20	Anxiety related response QTL 20	3.04		body movement coordination trait (VT:0005424)	number of rearing movements in an experimental apparatus (CMO:0001752)	18	41432971	83828827	Rat
6893683	Bw110	Body weight QTL 110	2.7	0.002	body mass (VT:0001259)	body weight (CMO:0000012)	18	43345022	83828827	Rat
8694366	Abfw8	Abdominal fat weight QTL 8	6.38	0.001	visceral adipose mass (VT:0010063)	abdominal fat pad weight to body weight ratio (CMO:0000095)	18	46640675	83828827	Rat
8694432	Bw165	Body weight QTL 165	3.81	0.001	body lean mass (VT:0010483)	lean tissue morphological measurement (CMO:0002184)	18	46640675	83828827	Rat
9589041	Epfw12	Epididymal fat weight QTL 12	17.08	0.001	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	18	46640675	83828827	Rat
2303571	Bw92	Body weight QTL 92	3		body mass (VT:0001259)	body weight (CMO:0000012)	18	48520044	83828827	Rat
2303584	Gluco55	Glucose level QTL 55	2		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	18	48520044	83828827	Rat
738008	Hcar14	Hepatocarcinoma resistance QTL 14	4.3		liver integrity trait (VT:0010547)	liver nonremodeling tumorous lesion number (CMO:0001462)	18	51464733	83218561	Rat
12880368	Bw187	Body weight QTL 187		0.045	body mass (VT:0001259)	body weight (CMO:0000012)	18	52539763	76104388	Rat
12904067	Cm122	Cardiac mass QTL 122		0.001	heart mass (VT:0007028)	heart wet weight to body weight ratio (CMO:0002408)	18	52539763	76104388	Rat
12904069	Cm123	Cardiac mass QTL 123		0.001	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	18	52539763	76104388	Rat
12904070	Cm124	Cardiac mass QTL 124		0.01	heart right ventricle mass (VT:0007033)	heart right ventricle weight to body weight ratio (CMO:0000914)	18	52539763	76104388	Rat
12904071	Am18	Aortic mass QTL 18		0.001	aorta mass (VT:0002845)	aorta weight to aorta length to body weight ratio (CMO:0002722)	18	52539763	76104388	Rat
12904073	Kidm71	Kidney mass QTL 71		0.001	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	18	52539763	76104388	Rat
2301417	Bp319	Blood pressure QTL 319		0.002	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	18	52539763	76104388	Rat
1298072	Cia26	Collagen induced arthritis QTL 26	3.6		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	18	54709769	83828827	Rat
724542	Kidm2	Kidney mass QTL 2	2.6		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	18	59172115	83828827	Rat
2301969	Bp324	Blood pressure QTL 324	4.05		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	18	59712417	76477814	Rat
70185	BpQTLcluster15	Blood pressure QTL cluster 15	4.61		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	18	59712417	76477814	Rat
70185	BpQTLcluster15	Blood pressure QTL cluster 15	4.61		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	18	59712417	76477814	Rat
70185	BpQTLcluster15	Blood pressure QTL cluster 15	4.61		arterial blood pressure trait (VT:2000000)	absolute change in mean arterial blood pressure (CMO:0000533)	18	59712417	76477814	Rat
70185	BpQTLcluster15	Blood pressure QTL cluster 15	4.61		arterial blood pressure trait (VT:2000000)	absolute change in systolic blood pressure (CMO:0000607)	18	59712417	76477814	Rat
6903353	Bp353	Blood pressure QTL 353	2.8		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	18	59796478	83828827	Rat
6903356	Bp354	Blood pressure QTL 354	4.6		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	18	59796478	83828827	Rat
61384	Bp48	Blood pressure QTL 48	19.4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	18	60622311	77209844	Rat
631675	Iddm15	Insulin dependent diabetes mellitus QTL 15			urine glucose amount (VT:0001758)	percentage of study population developing diabetes mellitus during a period of time (CMO:0001114)	18	60622311	77209844	Rat
634333	Pia19	Pristane induced arthritis QTL 19	3.4		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	18	73997140	79532029	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	100361818	UniSTS
	307231	UniSTS
UniSTS	121323	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D18Rat45