D17Rat60 Marker Search Result - Rat Genome Database

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes Community Projects (beta) QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

General

Marker: D17Rat60

Symbol:

D17Rat60

Previously known as:

R0080-C04; oxsts9893;

RGD ID:

38894

Expected Size:

239 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	17	77,112,882 - 77,113,120 (+)	MAPPER	mRatBN7.2
Rnor_6.0	17	81,202,848 - 81,203,085	NCBI	Rnor6.0
Rnor_5.0	17	82,947,449 - 82,947,686	UniSTS	Rnor5.0
RGSC_v3.4	17	88,268,816 - 88,269,054	RGD	RGSC3.4
RGSC_v3.4	17	88,268,817 - 88,269,054	UniSTS	RGSC3.4
RGSC_v3.1	17	88,279,649 - 88,279,887	RGD
Celera	17	76,446,002 - 76,446,239	UniSTS
SHRSP x BN Map	17	45.1899	UniSTS
SHRSP x BN Map	17	45.1899	RGD
FHH x ACI Map	17	60.89	RGD

Is Marker For:

Strains: AVN/Orl BBDP/Rhw BBDR/Rhw BC/CpbU BDIX/Han BN/SsNHsd BP/Cub BUF/Pit DA/PitN DON/Melb F344/Pit FHH/Eur IS/Kyo LE/Mol LEW/Pit LH/Mav MHS/Gib MNRA/N WN/N WKY/OlaHsd WTC/Kyo LOU/CHan MNR/N MR/Pit ODU/N WF/Pit WIST/Nhg SR/Jr MNS/Gib NP9 OKA/Wsl OM/Ztm P5C PVG/Pit SD/Rij SHR/OlaHsd SHRSP/Riv WAG/RijKyo GK/KyoSwe M520/N ACI/N BN-Lx/Cub LN/Mav GH/Omr NEDH/K SS/Jr COP/OlaHsd
Genes: LOC686159

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	Rat Genetic Map Data	Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3.	Electronic Transfer of SSLP Data	Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4.	UniSTS Pipeline	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	GGGGTCCAGCACTTAGCAT
Reverse Primer	GTTTTGATCATGGGGACGTT

Strain Variation

Strain, Expected Size(s)

ACI/N	242
AVN/Orl	244
BBDP/Rhw	244
BBDR/Rhw	244
BC/CpbU	242
BDIX/Han	242
BN-Lx/Cub	238
BN/SsNHsd	238
BP/Cub	244
BUF/Pit	244
COP/OlaHsd	240
DA/PitN	246

DON/Melb	244
F344/Pit	244
FHH/Eur	240
GH/Omr	240
GK/KyoSwe	238
IS/Kyo	240
LE/Mol	248
LEW/Pit	244
LH/Mav	244
LN/Mav	244
LOU/CHan	246
M520/N	246

MHS/Gib	244
MNR/N	242
MNRA/N	242
MNS/Gib	244
MR/Pit	242
NEDH/K	242
NP9	244
ODU/N	244
OKA/Wsl	242
OM/Ztm	244
P5C	244
PVG/Pit	240

SD/Rij	242
SHR/OlaHsd	248
SHRSP/Riv	242
SR/Jr	244
SS/Jr	244
WAG/RijKyo	246
WF/Pit	244
WIST/Nhg	244
WKY/OlaHsd	242
WN/N	244
WTC/Kyo	242

Region

Nucleotide Sequences


GenBank Nucleotide	CH473990	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CM000247	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1354663	Bvd5	Brain ventricular dilatation QTL 5	3.51	0.001	brain ventricle morphology trait (VT:0000822)	hydrocephalus severity score (CMO:0001881)	17	31990784	81292925	Rat
2301412	Kidm40	Kidney mass QTL 40		0.001	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	17	37479847	82479847	Rat
2317054	Aia12	Adjuvant induced arthritis QTL 12	4.24		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	17	38281509	83281509	Rat
2317060	Aia26	Adjuvant induced arthritis QTL 26	3.22		joint integrity trait (VT:0010548)	right rear ankle joint diameter (CMO:0002150)	17	38281509	83281509	Rat
1598871	Memor5	Memory QTL 5	5.3		exploratory behavior trait (VT:0010471)	total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)	17	40540041	80387013	Rat
1358295	Aocep1	Aortic cell protein QTL 1	6.1	0.00000071	thoracic aorta cellular protein amount (VT:0010598)	aortic cell percentage	17	40990005	85990005	Rat
7411575	Bw140	Body weight QTL 140	30.2	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	17	48560935	86533673	Rat
8694181	Bw151	Body weight QTL 151	4.36	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	17	48560935	86533673	Rat
2317038	Ginf3	Gastrointestinal inflammation QTL 3	2.89	0.005	liver integrity trait (VT:0010547)	liver granuloma severity score (CMO:0002157)	17	49920154	86533673	Rat
2303580	Gluco49	Glucose level QTL 49	2		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	17	50040271	86533673	Rat
4889894	Eae33	Experimental allergic encephalomyelitis QTL 33	5.2	0.0001	nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis severity score (CMO:0001419)	17	50909099	86022412	Rat
1354588	Bvd4	Brain ventricular dilatation QTL 4	5.31	0.001	brain ventricle morphology trait (VT:0000822)	hydrocephalus severity score (CMO:0001881)	17	53498828	82479847	Rat
2302365	Gluco40	Glucose level QTL 40	4.79		blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	17	57246843	82046127	Rat
7488963	Bp369	Blood pressure QTL 369		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	17	59005649	77910000	Rat
2317045	Aia11	Adjuvant induced arthritis QTL 11	4.06		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	17	60781426	86533673	Rat
7411577	Bw141	Body weight QTL 141		0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	17	62619516	86533673	Rat
631502	Cm26	Cardiac mass QTL 26	3.71		heart left ventricle mass (VT:0007031)	heart left ventricle wet weight (CMO:0000071)	17	65703580	81153923	Rat
1300129	Rf25	Renal function QTL 25	3.03		blood creatinine amount (VT:0005328)	creatinine clearance (CMO:0000765)	17	71003325	81153923	Rat
12904736	Cm121	Cardiac mass QTL 121		0.043	heart mass (VT:0007028)	heart wet weight to body weight ratio (CMO:0002408)	17	71774621	82479847	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	686159	UniSTS
UniSTS	226890	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D17Rat60