D17Rat84 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D17Rat84

Symbol: D17Rat84
Previously known as: R0077-B08; oxsts6413; 
RGD ID: 38706
Expected Size: 138 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21723,653,184 - 23,653,323 (+)MAPPERmRatBN7.2
Rnor_6.01721,490,950 - 21,491,085NCBIRnor6.0
Rnor_5.01723,473,207 - 23,473,342UniSTSRnor5.0
RGSC_v3.41729,604,089 - 29,604,224UniSTSRGSC3.4
RGSC_v3.41729,603,712 - 29,604,237RGDRGSC3.4
RGSC_v3.11729,606,930 - 29,607,065RGD
Celera1723,324,112 - 23,324,238UniSTS
RH 3.4 Map17280.1RGD
RH 3.4 Map17280.1UniSTS
RH 2.0 Map17199.7RGD
SHRSP x BN Map1717.2899RGD
FHH x ACI Map1722.3299RGD
Cytogenetic Map17p12UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   SS.LEW-(D17Rat84-D17Chm17)/Ayd  
QTLs:   Bp278   Insul5   Kidm32   Epfw4   Bw67   Bw64   Bw70   Bw73   Bw76   Bp370   Kidm70   Cm118   Cm119   Cm120   Am17  
Genes:   Gcm2  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer TCGTCAGCCAGACTCCCTAT
Reverse Primer CCAATCCCAAGTCTCCAGAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1311127Gcm2glial cells missing transcription factor 2172365263723661754Rat

Nucleotide Sequences
GenBank Nucleotide JH618936.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
10401807Kidm52Kidney mass QTL 52kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)17131701463Rat
70184BpQTLcluster14Blood pressure QTL cluster 143.38arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)17131990913Rat
631207Niddm41Non-insulin dependent diabetes mellitus QTL 41blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)17137830672Rat
1354658Spl8Serum phospholipid level QTL 83.8blood VLDL phospholipid amount (VT:0010507)blood very low density lipoprotein phospholipid level (CMO:0001571)17160781592Rat
1354581Bp247Blood pressure QTL 2474.5arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)17169599340Rat
1354662Rf49Renal function QTL 492.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)17169599340Rat
1300123Bp194Blood pressure QTL 1942.82arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)17211514934551001Rat
631499Stl1Serum triglyceride level QTL 13.6blood triglyceride amount (VT:0002644)blood triglyceride level (CMO:0000118)17327139827389946Rat
1354613Kidm14Kidney mass QTL 146.2kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)17429913035837242Rat
1354596Bw32Body weight QTL 324.5body mass (VT:0001259)body weight (CMO:0000012)17429913060781592Rat
1354630Cm34Cardiac mass QTL 348.7heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)17429913069599340Rat
1354638Insul1Insulin level QTL 14.8blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)17429913069599340Rat
1354651Lmblg2Limb length QTL 26tibia length (VT:0004357)tibia length (CMO:0000450)17429913069599340Rat
2293648Bmd31Bone mineral density QTL 314.50.0001femur size trait (VT:1000369)femoral neck cortical cross-sectional area (CMO:0001702)17435448727028127Rat
2293664Bmd28Bone mineral density QTL 285.10.0001femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)17435448727028127Rat
2303627Vencon8Ventilatory control QTL 80.001respiration trait (VT:0001943)tidal volume (CMO:0000222)17452803849528038Rat
10054088Scort28Serum corticosterone level QTL 282.040.0102blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)17452803849528038Rat
2303561Bw91Body weight QTL 912body mass (VT:0001259)body weight (CMO:0000012)17886846253868462Rat
1582199Insul5Insulin level QTL 53.40.0119blood insulin amount (VT:0001560)calculated serum insulin level (CMO:0000359)17920136523653323Rat
1582208Kidm32Kidney mass QTL 323.90.0018kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)17920136523653323Rat
1582224Epfw4Epididymal fat weight QTL 43.50.0058epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)17920136523653323Rat
1582225Bw67Body weight QTL 676.20.0001body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
1582226Bw64Body weight QTL 644.20.0017body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
1582241Bw70Body weight QTL 704.60.0003body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
1582245Bw73Body weight QTL 734.60.0004body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
1582258Bw76Body weight QTL 764.60.0005body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
2300002Iddm36Insulin dependent diabetes mellitus QTL 361.98blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)17999128640540197Rat
1331765Hrtrt15Heart rate QTL 154.094heart pumping trait (VT:2000009)heart rate (CMO:0000002)171533061355836425Rat
1354640Scl32Serum cholesterol level QTL 325.4blood HDL cholesterol amount (VT:0000184)blood high density lipoprotein cholesterol level (CMO:0000052)171578159260781592Rat
1354659Scl68Serum cholesterol level QTL 683.9blood VLDL cholesterol amount (VT:0005144)blood very low density lipoprotein cholesterol level (CMO:0000648)171578159260781592Rat
7394837Memor18Memory QTL 18exploratory behavior trait (VT:0010471)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)171864018263640182Rat
1354628Stl13Serum triglyceride level QTL 133.8blood triglyceride amount (VT:0002644)blood triglyceride level (CMO:0000118)172129303960781592Rat
70157Niddm32Non-insulin dependent diabetes mellitus QTL 324.34blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)172245492450909196Rat
61394Bp8Blood pressure QTL 82.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)172308056759555013Rat
7488966Bp370Blood pressure QTL 3700.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172365318457246843Rat
12903978Cm118Cardiac mass QTL 1180.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)172365318468653184Rat
12903979Cm119Cardiac mass QTL 1190.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)172365318468653184Rat
12903980Cm120Cardiac mass QTL 1200.002heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)172365318468653184Rat
12903981Am17Aortic mass QTL 170.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)172365318468653184Rat
1559055Bp278Blood pressure QTL 2780.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172365318468653184Rat
12903982Kidm70Kidney mass QTL 700.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)172365318470974005Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100302856 UniSTS
  100302862 UniSTS
  100303042 UniSTS
  100303044 UniSTS
  100303046 UniSTS
  100303217 UniSTS
  100303224 UniSTS
  100303346 UniSTS
  291047 UniSTS
UniSTS 118451 UniSTS