D13Rat85 Marker Search Result - Rat Genome Database

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

General

Marker: D13Rat85

Symbol:

D13Rat85

Previously known as:

R0063-A08; oxsts6179;

RGD ID:

37844

Expected Size:

140 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	13	69,060,519 - 69,060,785 (+)	MAPPER	mRatBN7.2
mRatBN7.2	13	69,060,649 - 69,060,785 (+)	MAPPER	mRatBN7.2
Rnor_6.0	13	74,568,563 - 74,568,698	NCBI	Rnor6.0
Rnor_6.0	13	74,568,378 - 74,568,698	NCBI	Rnor6.0
Rnor_5.0	13	79,489,166 - 79,489,301	UniSTS	Rnor5.0
Rnor_5.0	13	79,488,981 - 79,489,301	UniSTS	Rnor5.0
RGSC_v3.4	13	72,141,292 - 72,141,428	RGD	RGSC3.4
RGSC_v3.4	13	72,141,293 - 72,141,428	UniSTS	RGSC3.4
RGSC_v3.1	13	72,155,481 - 72,155,616	RGD
Celera	13	68,923,954 - 68,924,089	UniSTS
RH 3.4 Map	13	394.3	RGD
RH 3.4 Map	13	394.3	UniSTS
SHRSP x BN Map	13	26.0799	UniSTS
SHRSP x BN Map	13	26.0799	RGD
FHH x ACI Map	13	30.3999	RGD
Cytogenetic Map	13	q22	UniSTS

Is Marker For:

Strains: AVN/Orl BBDP/Rhw BBDR/Rhw BC/CpbU BDIX/Han BN/SsNHsd BP/Cub BUF/Pit DA/PitN DON/Melb F344/Pit FHH/Eur IS/Kyo LE/Mol LEW/Pit LH/Mav MHS/Gib MNRA/N WN/N WKY/OlaHsd WTC/Kyo LOU/CHan MNR/N MR/Pit ODU/N WF/Pit WIST/Nhg SR/Jr MNS/Gib OKA/Wsl OM/Ztm P5C PVG/Pit SD/Rij SHR/OlaHsd SHRSP/Riv WAG/RijKyo GK/KyoSwe M520/N ACI/N BN-Lx/Cub LN/Mav GH/Omr NEDH/K SS/Jr COP/OlaHsd CDS.SBN-(D13Rat85-D13Mit4)/Ygl
QTLs: Bp221 Kidm6 Pur29 Rf61 Rf63
Genes: Ralgps2

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.	Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3.	Rat Genetic Map Data	Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4.	Electronic Transfer of SSLP Data	Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5.	UniSTS Pipeline	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	GAAAACCGAGGTTTCTGCTG
Reverse Primer	GGCAATTCAGAGGTAGGTGTG

Template	CNCAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCTGGGACCGAACCCAGG GCCTTGCGCTTCCTAGGTAAGCGCTACTTTTTCCCAGAGTACTCCACATACTATAAGGCAATTC AGAGGTAGGTGTGTGTAGGGGTACAGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT ACATGACTATAGCAAGGCAGTGCTACAGTAGCAGGAACAGTACCAGGACAGCAGAAACCTCGGT TTTCAGTGTCAGATCTGTGATGCTGCAGCAAGAGAGTAGGGGTACCGAGCTCGAATTCGTAATC ATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCC GGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGC GCTCANTGCCCGNTTTCCAGTCGGGAAACCTGTCGTGCANCTGCATTAATGAATCGCCCANCGC GCGGGGANAGGGNTTTNG

Strain Variation

Strain, Expected Size(s)

ACI/N	156
AVN/Orl	138
BBDP/Rhw	138
BBDR/Rhw	138
BC/CpbU	146
BDIX/Han	132
BN-Lx/Cub	138
BN/SsNHsd	138
BP/Cub	156
BUF/Pit	158
COP/OlaHsd	156
DA/PitN	158

DON/Melb	158
F344/Pit	158
FHH/Eur	158
GH/Omr	158
GK/KyoSwe	138
IS/Kyo	140
LE/Mol	156
LEW/Pit	138
LH/Mav	144
LN/Mav	144
LOU/CHan	138
M520/N	158

MHS/Gib	158
MNR/N	158
MNRA/N	144
MNS/Gib	138
MR/Pit	158
NEDH/K	144
ODU/N	142
OKA/Wsl	142
OM/Ztm	156
P5C	138
PVG/Pit	158
SD/Rij	138

SHR/OlaHsd	142
SHRSP/Riv	144
SR/Jr	144
SS/Jr	144
WAG/RijKyo	138
WF/Pit	144
WIST/Nhg	138
WKY/OlaHsd	138
WN/N	158
WTC/Kyo	142

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1311537	Ralgps2	Ral GEF with PH domain and SH3 binding motif 2	13	68924674	69104637	Rat

Nucleotide Sequences


GenBank Nucleotide	CH473958	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CM000243	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1354666	Bp244	Blood pressure QTL 244	4.9		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	13	1	101056920	Rat
1354666	Bp244	Blood pressure QTL 244	4.9		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	1	101056920	Rat
1354666	Bp244	Blood pressure QTL 244	4.9		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	1	101056920	Rat
1581554	Pur11	Proteinuria QTL 11			urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	13	5994833	77046787	Rat
1581573	Uae36	Urinary albumin excretion QTL 36			urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	13	5994833	77046787	Rat
1581570	Eae17	Experimental allergic encephalomyelitis QTL 17	4.1		nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)	13	8897350	101631289	Rat
7207885	Glom27	Glomerulus QTL 27	3.9		kidney glomerulus integrity trait (VT:0010546)	kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)	13	20605871	101339738	Rat
1354621	Rf47	Renal function QTL 47	3.7		kidney renin amount (VT:0010559)	kidney renin level (CMO:0002166)	13	30395351	101056920	Rat
70181	BpQTLcluster11	Blood pressure QTL cluster 11	6.922		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	13	31241331	93395974	Rat
70181	BpQTLcluster11	Blood pressure QTL cluster 11	6.922		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	31241331	93395974	Rat
70181	BpQTLcluster11	Blood pressure QTL cluster 11	6.922		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	31241331	93395974	Rat
70181	BpQTLcluster11	Blood pressure QTL cluster 11	6.922		arterial blood pressure trait (VT:2000000)	absolute change in mean arterial blood pressure (CMO:0000533)	13	31241331	93395974	Rat
2303563	Bw89	Body weight QTL 89	6		body mass (VT:0001259)	body weight (CMO:0000012)	13	32284471	77284471	Rat
61340	Bp25	Blood pressure QTL 25	4.2	0.004	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	34535218	79535218	Rat
12879477	Bp401	Blood pressure QTL 401			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	37262092	82262092	Rat
61349	Bp31	Blood pressure QTL 31	5.75		arterial blood pressure trait (VT:2000000)	blood pressure measurement (CMO:0000003)	13	37374509	82374509	Rat
70220	Bp55	Blood pressure QTL 55	5.75		arterial blood pressure trait (VT:2000000)	blood pressure measurement (CMO:0000003)	13	37374509	82374509	Rat
4889861	Pur29	Proteinuria QTL 29	13.8	0.005	urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	13	37415584	80753406	Rat
1331750	Bp220	Blood pressure QTL 220	2.98		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	13	37415584	82415584	Rat
1549897	Stresp12	Stress response QTL 12	3.35		stress-related behavior trait (VT:0010451)	number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)	13	38433408	83433408	Rat
619615	Bp80	Blood pressure QTL 80		0.0354	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	39754544	84754544	Rat
12879444	Bp397	Blood pressure QTL 397			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	45049404	90049404	Rat
12879471	Bp398	Blood pressure QTL 398			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	45514719	90514719	Rat
12879441	Bp396	Blood pressure QTL 396			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	45699983	90699983	Rat
1298066	Bp159	Blood pressure QTL 159		0.004	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	46088046	91088046	Rat
71119	Thym2	Thymus enlargement QTL 2	3.8		thymus mass (VT:0004954)	thymus weight to body weight ratio (CMO:0000612)	13	46197976	84753113	Rat
1641901	Alcrsp6	Alcohol response QTL 6			response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	13	52362171	97362171	Rat
1354655	Bp241	Blood pressure QTL 241	3.9		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	56056920	101056920	Rat
2303028	Bp329	Blood pressure QTL 329			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	58497872	73485113	Rat
724564	Uae11	Urinary albumin excretion QTL 11	5.7		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	13	59492522	77046890	Rat
738026	Lnnr5	Liver neoplastic nodule remodeling QTL 5	3.29		liver integrity trait (VT:0010547)	liver remodeling tumorous lesion number (CMO:0001461)	13	59874408	85581182	Rat
12879475	Bp400	Blood pressure QTL 400			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	61825626	106807694	Rat
2293702	Bss34	Bone structure and strength QTL 34	4.61	0.0001	femur strength trait (VT:0010010)	femur midshaft polar moment of inertia (CMO:0001669)	13	65103704	106807694	Rat
2293687	Bss26	Bone structure and strength QTL 26	4.6	0.0001	femur morphology trait (VT:0000559)	femur cross-sectional area (CMO:0001661)	13	65103704	106807694	Rat
8655951	Rf63	Renal function QTL 63	12.2		blood urea nitrogen amount (VT:0005265)	plasma urea nitrogen level (CMO:0000586)	13	69060519	77046890	Rat
8655945	Rf61	Renal function QTL 61	3.6		blood creatinine amount (VT:0005328)	creatinine clearance (CMO:0000765)	13	69060519	86800898	Rat
1331783	Bp221	Blood pressure QTL 221	3.72886		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	69060519	86800898	Rat
1300166	Kidm6	Kidney mass QTL 6	3.93		kidney mass (VT:0002707)	single kidney wet weight to body weight ratio (CMO:0000622)	13	69060519	86800898	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	100528041	UniSTS
	304887	UniSTS
	444965	UniSTS
	544403	UniSTS
UniSTS	118343	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D13Rat85