DXRat53 Marker Search Result - Rat Genome Database

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

General

Marker: DXRat53

Symbol:

DXRat53

Previously known as:

R0062-A05; oxsts11797;

RGD ID:

37772

Expected Size:

279 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	5	103,857,355 - 103,857,402 (+)	MAPPER	mRatBN7.2
mRatBN7.2	1	79,536,234 - 79,536,294 (+)	MAPPER	mRatBN7.2
mRatBN7.2	10	48,432,239 - 48,432,272 (-)	MAPPER	mRatBN7.2
mRatBN7.2	7	39,100,176 - 39,100,207 (-)	MAPPER	mRatBN7.2
mRatBN7.2	X	18,403,104 - 18,403,385 (-)	MAPPER	mRatBN7.2
Rnor_6.0	X	19,292,869 - 19,293,154	NCBI	Rnor6.0
Rnor_6.0	X	19,245,739 - 19,246,017	NCBI	Rnor6.0
Rnor_5.0	X	20,011,470 - 20,011,748	UniSTS	Rnor5.0
RGSC_v3.4	X	38,582,727 - 38,582,995	UniSTS	RGSC3.4
RGSC_v3.4	X	38,516,405 - 38,516,745	RGD	RGSC3.4
RGSC_v3.4	X	38,516,455 - 38,516,733	UniSTS	RGSC3.4
RGSC_v3.1	X	38,636,196 - 38,636,464	RGD
Celera	X	18,625,109 - 18,625,377	UniSTS
RH 3.4 Map	X	187.5	RGD
RH 3.4 Map	X	187.5	UniSTS
RH 2.0 Map	21	198.2	RGD
FHH x ACI Map	X	5.73	RGD

Is Marker For:

Strains: BBDP/Rhw BBDR/Rhw BC/CpbU MNR/N COP/OlaHsd BDVII/Cub BP/Cub BUF/Pit DA/PitN DON/Melb F344/Pit IS/Kyo LE/Mol LH/Mav MHS/Gib MNRA/N WN/N WKY/OlaHsd MR/Pit ODU/N WF/Pit WIST/Nhg SR/Jr OKA/Wsl OM/Ztm P5C PVG/Pit SD/Rij SHR/OlaHsd SHRSP/Riv M520/N ACI/N LN/Mav GH/Omr NEDH/K SS/Jr

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.	Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3.	Rat Genetic Map Data	Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4.	Electronic Transfer of SSLP Data	Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5.	UniSTS Pipeline	RGD automated pipelines
6.	RH Map Project	RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7.	A high density integrated genetic linkage and radiation hybrid map of the laboratory rat	Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence


Forward Primer	TCTTTGTATGTTCTCAGTCAGGTCA
Reverse Primer	TCCAGGCACTGGAGTCTCTT

Strain Variation

Strain, Expected Size(s)

ACI/N	274
BBDP/Rhw	274
BBDR/Rhw	274
BC/CpbU	274
BDVII/Cub	274
BP/Cub	274
BUF/Pit	274
COP/OlaHsd	274
DA/PitN	274
DON/Melb	274

F344/Pit	274
GH/Omr	274
IS/Kyo	274
LE/Mol	274
LH/Mav	274
LN/Mav	274
M520/N	274
MHS/Gib	274
MNR/N	274
MNRA/N	274

MR/Pit	274
NEDH/K	274
ODU/N	278
OKA/Wsl	278
OM/Ztm	274
P5C	274
PVG/Pit	274
SD/Rij	274
SHR/OlaHsd	276
SHRSP/Riv	278

SR/Jr	274
SS/Jr	274
WF/Pit	274
WIST/Nhg	274
WKY/OlaHsd	278
WN/N	274

Region

Nucleotide Sequences


GenBank Nucleotide	CH474063	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CM000251	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
70212	Niddm25	Non-insulin dependent diabetes mellitus QTL 25	3.54		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	5	1	131345958	Rat
1576314	Eutr1	Estrogen induced uterine response QTL 1			uterus integrity trait (VT:0010575)	pyometritis severity score (CMO:0002009)	5	2138965	166875058	Rat
634305	Mamtr1	Mammary tumor resistance QTL 1		0.0001	mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	12789751	113558310	Rat
2290448	Scl54	Serum cholesterol level QTL 54	2.93		blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	5	31663789	131345958	Rat
1576317	Eutr2	Estrogen induced uterine response QTL 2		0.01	uterus integrity trait (VT:0010575)	pyometritis severity score (CMO:0002009)	5	34730116	104251008	Rat
2316959	Gluco59	Glucose level QTL 59	4.7		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	5	34944474	113558310	Rat
1641912	Alcrsp18	Alcohol response QTL 18			response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	5	35189153	141643988	Rat
1549845	Scl44	Serum cholesterol level QTL 44	6		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	40128307	148607290	Rat
1331801	Rf33	Renal function QTL 33	4.149		kidney blood vessel physiology trait (VT:0100012)	absolute change in renal vascular resistance (CMO:0001900)	5	43726656	129132602	Rat
1578766	Tcas11	Tongue tumor susceptibility QTL 11	4.12		tongue integrity trait (VT:0010553)	number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)	5	46711509	161317411	Rat
1576312	Emca8	Estrogen-induced mammary cancer QTL 8	4.1		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	50328551	141643988	Rat
70189	Mcs5	Mammary carcinoma susceptibility QTL 5	10.51		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	55805606	132207589	Rat
1358895	Bp254	Blood pressure QTL 254	3.6	0.0003	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	5	58829236	128034027	Rat
61426	Scl2	Serum cholesterol level QTL 2	7.3	0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	59793399	143070159	Rat
2316957	Pur21	Proteinuria QTL 21	6.2		urine protein amount (VT:0005160)	urine protein level (CMO:0000591)	5	59793528	113558156	Rat
61393	Bp7	Blood pressure QTL 7	4.5	0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	60293434	161481680	Rat
2290005	Mcs24	Mammary carcinoma susceptibility QTL 24			mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	64719390	109719390	Rat
2306971	Anxrr21	Anxiety related response QTL 21	9.47		fear/anxiety-related behavior trait (VT:1000241)	number of entries into a discrete space in an experimental apparatus (CMO:0000960)	5	66174080	124160948	Rat
2312671	Scl64	Serum cholesterol level QTL 64		0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	68984307	104251008	Rat
61380	Edpm5	Estrogen-dependent pituitary mass QTL 5	4.5	0.92	pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	5	68984307	104251008	Rat
1357396	Bw44	Body weight QTL 44	4.19		body mass (VT:0001259)	body weight (CMO:0000012)	5	68984307	104251008	Rat
1357402	Bw46	Body weight QTL 46	4.47		body mass (VT:0001259)	body mass index (BMI) (CMO:0000105)	5	68984307	104251008	Rat
2302381	Bw84	Body weight QTL 84	4.47		body mass (VT:0001259)	body mass index (BMI) (CMO:0000105)	5	68984307	104251008	Rat
1354598	Srn6	Serum renin concentration QTL 6	3.8		blood renin amount (VT:0003349)	plasma renin activity level (CMO:0000116)	5	69540295	151018848	Rat
1298070	Scl18	Serum cholesterol level QTL 18	3.7		blood LDL cholesterol amount (VT:0000181)	calculated plasma low density lipoprotein cholesterol level (CMO:0001245)	5	79584860	124584860	Rat
1598846	Bp293	Blood pressure QTL 293	3.9		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	79584860	124584860	Rat
1598859	Cm66	Cardiac mass QTL 66	2		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	5	79584860	124584860	Rat
1302790	Scl20	Serum cholesterol level QTL 20	6.4	0.0001	blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	5	82394392	166664054	Rat
1298086	Bp156	Blood pressure QTL 156			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	84132602	129132602	Rat
7411601	Foco12	Food consumption QTL 12	19.7	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	5	87468046	132468046	Rat
7411564	Bw135	Body weight QTL 135		0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	5	87468046	132468046	Rat
7411582	Foco3	Food consumption QTL 3	7.5	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	5	87468046	132468046	Rat
6903316	Bw113	Body weight QTL 113	2	0.0103	body mass (VT:0001259)	body weight (CMO:0000012)	5	87765973	132765973	Rat
1358889	Bp261	Blood pressure QTL 261	2.86		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	5	90067849	128034027	Rat
1358909	Kidm25	Kidney mass QTL 25	1.87		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	5	90067849	128034027	Rat
631527	Tls1	T-lymphoma susceptibility QTL 1	0	0.001	thymus integrity trait (VT:0010555)	post-insult time to onset of T-cell lymphoma (CMO:0001907)	5	90450144	135450144	Rat
61452	Ciaa5	CIA Autoantibody QTL 5	3.5		blood autoantibody amount (VT:0003725)	calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)	5	94858972	143070159	Rat
1331796	Thshl2	Thyroid stimulating hormone level QTL 2	2.3		blood thyroid-stimulating hormone amount (VT:0005119)	serum thyroid stimulating hormone level (CMO:0001248)	5	97059760	147465714	Rat
2317753	Glom24	Glomerulus QTL 24	3.1		kidney glomerulus integrity trait (VT:0010546)	kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)	5	97570330	136479578	Rat
1582212	Livw2	Liver weight QTL 2	3.5	0.0004	liver mass (VT:0003402)	liver weight to body weight ratio (CMO:0000633)	5	99016066	119085810	Rat
1358187	Emca1	Estrogen-induced mammary cancer QTL 1	4.4		mammary gland integrity trait (VT:0010552)	post-insult time to mammary tumor formation (CMO:0000345)	5	99216724	148607142	Rat
7394708	Emca11	Estrogen-induced mammary cancer QTL 11			mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	99753548	113061097	Rat
1578673	Bmd13	Bone mineral density QTL 13	4.9		femur mineral mass (VT:0010011)	trabecular volumetric bone mineral density (CMO:0001729)	5	103689353	148689353	Rat
70223	Bp57	Blood pressure QTL 57	5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	1	80676123	Rat
631554	Bp133	Blood pressure QTL 133		0.005	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	743364	63851208	Rat
2313064	Bmd71	Bone mineral density QTL 71	0.9	0.0001	tibia mineral mass (VT:1000283)	compact volumetric bone mineral density (CMO:0001730)	10	5387014	50387014	Rat
2313066	Bss63	Bone structure and strength QTL 63	1.4	0.0001	tibia strength trait (VT:1000284)	bone polar moment of inertia (CMO:0001558)	10	5387014	50387014	Rat
2313081	Bss64	Bone structure and strength QTL 64	1.3	0.0001	tibia strength trait (VT:1000284)	tibia total energy absorbed before break (CMO:0001736)	10	5387014	50387014	Rat
2313095	Bss62	Bone structure and strength QTL 62	1.5	0.0001	tibia size trait (VT:0100001)	tibia midshaft cross-sectional area (CMO:0001717)	10	5387014	50387014	Rat
2313104	Bss61	Bone structure and strength QTL 61	0.9	0.0001	tibia area (VT:1000281)	tibia midshaft cross-sectional area (CMO:0001717)	10	5387014	50387014	Rat
2298544	Neuinf9	Neuroinflammation QTL 9	4.6		nervous system integrity trait (VT:0010566)	spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)	10	5801990	62146030	Rat
8662860	Vetf10	Vascular elastic tissue fragility QTL 10			artery integrity trait (VT:0010639)	number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)	10	6154182	73453136	Rat
61427	Cia16	Collagen induced arthritis QTL 16	3.2		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	6357896	96121100	Rat
1578761	Stresp21	Stress response QTL 21	3.3		thymus mass (VT:0004954)	thymus wet weight (CMO:0000855)	10	6375746	51375746	Rat
2303118	Mamtr7	Mammary tumor resistance QTL 7		0.003	mammary gland integrity trait (VT:0010552)	mammary tumor growth rate (CMO:0000344)	10	9658275	104670812	Rat
9590310	Scort19	Serum corticosterone level QTL 19	6.3	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	10	11474010	56474010	Rat
9590268	Scort13	Serum corticosterone level QTL 13	3.26	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	10	11474010	56474010	Rat
9589136	Insul27	Insulin level QTL 27	10.46	0.001	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	10	11474010	56474010	Rat
2301967	Cm73	Cardiac mass QTL 73	4.55		heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	10	14487011	89062041	Rat
631268	Cia21	Collagen induced arthritis QTL 21	3.1		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	14487011	104060283	Rat
2316949	Gluco60	Glucose level QTL 60	3.7		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	10	14487011	107057807	Rat
1354587	Kidm21	Kidney mass QTL 21	3.3		kidney mass (VT:0002707)	right kidney wet weight (CMO:0000082)	10	15028513	60430477	Rat
631564	Apr3	Acute phase response QTL 3	3.9		blood interleukin-6 amount (VT:0008595)	plasma interleukin-6 level (CMO:0001927)	10	15275955	60275955	Rat
6893350	Bw99	Body weight QTL 99	0.87	0.16	body mass (VT:0001259)	body weight (CMO:0000012)	1	15906665	60906665	Rat
6893352	Bw100	Body weight QTL 100	0.33	0.6	body mass (VT:0001259)	body weight (CMO:0000012)	1	15906665	60906665	Rat
631532	Cm50	Cardiac mass QTL 50	6.6		heart mass (VT:0007028)	calculated heart weight (CMO:0000073)	10	17907113	51786432	Rat
1598852	Anxrr19	Anxiety related response QTL 19	5.07		body movement coordination trait (VT:0005424)	number of rearing movements in an experimental apparatus (CMO:0001752)	10	18167841	63167841	Rat
2313055	Bw96	Body weight QTL 96	3.6	0.0001	body mass (VT:0001259)	body weight (CMO:0000012)	10	19606483	64606483	Rat
2313087	Bmd80	Bone mineral density QTL 80	3.2	0.0001	tibia mineral mass (VT:1000283)	total volumetric bone mineral density (CMO:0001728)	10	19606483	64606483	Rat
1554317	Bmd4	Bone mineral density QTL 4	9.4	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	10	19816042	99406971	Rat
1581497	Esta1	Estrogen-induced thymic atrophy QTL 1			thymus mass (VT:0004954)	thymus wet weight (CMO:0000855)	10	21329805	61345413	Rat
724556	Pur2	Proteinuria QTL 2	5.5		urine protein amount (VT:0005160)	urine protein level (CMO:0000591)	10	22427500	90627625	Rat
61354	Pia10	Pristane induced arthritis QTL 10		0.01	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	23444813	104060283	Rat
631267	Cia20	Collagen induced arthritis QTL 20	3.2		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	23444813	104060283	Rat
61325	Aia5	Adjuvant induced arthritis QTL 5		0.01	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	23444813	104060283	Rat
70224	Eae3	Experimental allergic encephalomyelitis QTL 3	4.1		nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)	10	26521957	61345413	Rat
1298069	Bp168	Blood pressure QTL 168	5.5		blood pressure trait (VT:0000183)	systolic blood pressure (CMO:0000004)	10	26521957	98003205	Rat
631542	Bp82	Blood pressure QTL 82	6.8		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	26521957	98952741	Rat
2300171	Bmd58	Bone mineral density QTL 58	4.9	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	10	26944628	71944628	Rat
10402859	Bp381	Blood pressure QTL 381		0.002	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	27606468	72606468	Rat
2292441	Bp308	Blood pressure QTL 308			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	27606468	72606468	Rat
724527	Bp148	Blood pressure QTL 148		0.0001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	28453136	73453136	Rat
1600371	Mcs21	Mammary carcinoma susceptibility QTL 21	3		mammary gland integrity trait (VT:0010552)	mammary tumor growth rate (CMO:0000344)	10	28875650	52200160	Rat
1331762	Rf40	Renal function QTL 40	3.873		kidney blood vessel physiology trait (VT:0100012)	absolute change in renal vascular resistance (CMO:0001900)	10	29299504	64155584	Rat
1331791	Cm31	Cardiac mass QTL 31	3.84606		heart mass (VT:0007028)	heart wet weight (CMO:0000069)	10	29299504	107211142	Rat
631557	Bp136	Blood pressure QTL 136		0.003	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	30632053	75632053	Rat
1576311	Pia26	Pristane induced arthritis QTL 26			joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	31224026	75632053	Rat
1578779	Tcas10	Tongue tumor susceptibility QTL 10	3.12		tongue integrity trait (VT:0010553)	number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)	10	31297439	76297439	Rat
1576319	Cia29	Collagen induced arthritis QTL 29			joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	33973921	78973921	Rat
1354614	Hpcl1	Hepatic cholesterol level QTL 1	3.3		liver cholesterol amount (VT:0010498)	liver cholesterol level (CMO:0001597)	10	35392267	51793994	Rat
1358897	Stresp6	Stress response QTL 6	4.17	0.022	blood norepinephrine amount (VT:0005663)	plasma norepinephrine level (CMO:0001010)	10	35392267	64155584	Rat
61441	Btemp1	Thermal response to stress QTL 1	4		body temperature trait (VT:0005535)	core body temperature (CMO:0001036)	10	35392457	63642539	Rat
2317042	Aia20	Adjuvant induced arthritis QTL 20	3.38		joint integrity trait (VT:0010548)	right rear ankle joint diameter (CMO:0002150)	10	37565079	82565079	Rat
2317043	Aia7	Adjuvant induced arthritis QTL 7	3.82		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	10	37565079	82565079	Rat
1576308	Schws1	Schwannoma susceptibility QTL 1		0.0041	nervous system integrity trait (VT:0010566)	percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)	10	40035094	102359817	Rat
631269	Cia22	Collagen induced arthritis QTL 22	8.9		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	40035094	104060283	Rat
631270	Cia23	Collagen induced arthritis QTL 23	3.9		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	40035094	104060283	Rat
631552	Vetf2	Vascular elastic tissue fragility QTL 2	4.5	0.0002	aorta elastic tissue integrity trait (VT:0010556)	artery internal elastic lamina non-tumorous lesion count (CMO:0001913)	10	41142633	86142633	Rat
61463	Bp12	Blood pressure QTL 12	6.3	0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	41333258	86333258	Rat
8552805	Bw145	Body weight QTL 145	2.2		body mass (VT:0001259)	change in body weight to body weight ratio (CMO:0002216)	10	41944526	78307017	Rat
1298078	Stresp5	Stress response QTL 5	2.99	0.00025	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	10	42045676	104670812	Rat
70188	BpQTLcluster1	Blood pressure QTL cluster 1	4.864		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	1	42323132	87323132	Rat
70188	BpQTLcluster1	Blood pressure QTL cluster 1	4.864		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	42323132	87323132	Rat
70188	BpQTLcluster1	Blood pressure QTL cluster 1	4.864		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	42323132	87323132	Rat
70188	BpQTLcluster1	Blood pressure QTL cluster 1	4.864		arterial blood pressure trait (VT:2000000)	pulse pressure (CMO:0000292)	1	42323132	87323132	Rat
70198	BpQTLcluster9	Blood pressure QTL cluster 9	2.94		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	42323132	87323132	Rat
6893342	Cm78	Cardiac mass QTL 78	0.1	0.88	heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	10	42876766	79813922	Rat
9589030	Epfw9	Epididymal fat weight QTL 9	19.24	0.001	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	10	44441699	89441699	Rat
7411614	Foco18	Food consumption QTL 18		0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	10	44441699	89441699	Rat
8694173	Bw149	Body weight QTL 149	4.38	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	10	44441699	89441699	Rat
2300218	Hpcl2	Hepatic cholesterol level QTL 2			liver cholesterol amount (VT:0010498)	liver cholesterol level (CMO:0001597)	10	45029650	95600334	Rat
631547	Bp87	Blood pressure QTL 87	4.5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	47369470	92369470	Rat
61410	Bw19	Body weight QTL 19	6.2	0.001	body mass (VT:0001259)	body weight (CMO:0000012)	7	1	44782185	Rat
631503	Bp102	Blood pressure QTL 102	1.9		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	7	1	44822433	Rat
634336	Anxrr17	Anxiety related response QTL 17	3.66		locomotor behavior trait (VT:0001392)	number of entries into a discrete space in an experimental apparatus (CMO:0000960)	7	924703	115097879	Rat
10755438	Coatc9	Coat color QTL 9		0	coat/hair pigmentation trait (VT:0010463)	pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)	7	3529280	48529280	Rat
9590102	Sffal5	Serum free fatty acids level QTL 5	8.62	0.001	blood free fatty acid amount (VT:0001553)	plasma free fatty acids level (CMO:0000546)	7	5329019	50329019	Rat
10755440	Coatc10	Coat color QTL 10		0	coat/hair pigmentation trait (VT:0010463)	pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)	7	7496499	52496499	Rat
10059592	Kidm45	Kidney mass QTL 45	3.95	0.025	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	7	7573985	52573985	Rat
2298547	Neuinf5	Neuroinflammation QTL 5	3.7		nervous system integrity trait (VT:0010566)	spinal cord Cd74 protein level (CMO:0002131)	7	9462246	58265113	Rat
1643004	Pain2	Pain QTL 2	1		mechanical nociception trait (VT:0002734)	self mutilation severity score (CMO:0002145)	7	9462246	98011544	Rat
1578652	Bmd15	Bone mineral density QTL 15	5.2		femur mineral mass (VT:0010011)	trabecular volumetric bone mineral density (CMO:0001729)	7	9866467	60460686	Rat
738033	Anxrr6	Anxiety related response QTL 6	4.1		exploratory behavior trait (VT:0010471)	percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)	7	15573889	60573889	Rat
2317059	Aia15	Adjuvant induced arthritis QTL 15	2.46		joint integrity trait (VT:0010548)	right rear ankle joint diameter (CMO:0002150)	7	17004598	62004598	Rat
10755451	Coatc11	Coat color QTL 11		0	coat/hair pigmentation trait (VT:0010463)	pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)	7	17944357	62944357	Rat
1354637	Scl30	Serum cholesterol level QTL 30	3.7		blood cholesterol amount (VT:0000180)	blood total cholesterol level (CMO:0000051)	7	19654317	49753746	Rat
1354644	Spl4	Serum phospholipid level QTL 4	4.9		blood phospholipid amount (VT:0006084)	blood phospholipid level (CMO:0001169)	7	19654317	49753746	Rat
1354639	Spl5	Serum phospholipid level QTL 5	3.9		blood LDL phospholipid amount (VT:0010505)	blood low density lipoprotein phospholipid level (CMO:0001568)	7	19654317	52888450	Rat
1300132	Bp182	Blood pressure QTL 182	3.49		arterial blood pressure trait (VT:2000000)	blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)	7	19654317	84928080	Rat
7411569	Bw137	Body weight QTL 137		0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	7	21921195	66921195	Rat
1641885	Alcrsp9	Alcohol response QTL 9			alcohol metabolism trait (VT:0015089)	blood ethanol level (CMO:0000535)	7	24099606	69099606	Rat
1549840	Bss5	Bone structure and strength QTL 5	9.8		femur strength trait (VT:0010010)	femur midshaft polar moment of inertia (CMO:0001669)	7	24751841	69751841	Rat
70190	Mcs6	Mammary carcinoma susceptibility QTL 6	2.29		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	7	26737401	63902784	Rat
1300138	Hrtrt9	Heart rate QTL 9	4.72		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	7	29409683	53612950	Rat
10402855	Bp379	Blood pressure QTL 379		0.21	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	7	29409683	74409683	Rat
1300127	Srn1	Serum renin concentration QTL 1	3.87		blood renin amount (VT:0003349)	plasma renin activity level (CMO:0000116)	7	29409683	84928080	Rat
10755453	Coatc12	Coat color QTL 12		0	coat/hair pigmentation trait (VT:0010463)	pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)	7	31112832	76112832	Rat
7411605	Foco14	Food consumption QTL 14	24.1	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	7	34293282	79293282	Rat
631534	Lnnr1	Liver neoplastic nodule remodeling QTL 1	3.85	0.001	liver integrity trait (VT:0010547)	liver remodeling tumorous lesion number to liver total tumorous lesion number ratio (CMO:0001705)	7	34293282	79293282	Rat
631513	Scl7	Serum cholesterol level QTL 7	4.1		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	7	37960569	82960569	Rat
731181	Uae27	Urinary albumin excretion QTL 27	2.7	0.0059	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	X	1	43491017	Rat
634325	Bw13	Body weight QTL 13	0		body mass (VT:0001259)	body weight (CMO:0000012)	X	1447972	20991088	Rat
70165	Bp64	Blood pressure QTL 64	5.2		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	X	1448129	31706553	Rat
631204	Gluco15	Glucose level QTL 15		0.001	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	X	1623715	22646544	Rat
1298071	Edpm12	Estrogen-dependent pituitary mass QTL 12	3.2		pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	X	2927898	47927898	Rat
10755455	Coatc13	Coat color QTL 13		0	coat/hair pigmentation trait (VT:0010463)	pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)	7	4406000	49406000	Rat
631666	Iddm5	Insulin dependent diabetes mellitus QTL 5			blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	X	4494549	49494549	Rat
61430	Cia18	Collagen induced arthritis QTL 18	3.1		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	X	14843113	120568734	Rat
71116	Niddm16	Non-insulin dependent diabetes mellitus QTL 16	7.81		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	X	15297802	60297802	Rat
1554320	Bmd1	Bone mineral density QTL 1	12.2	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	1	509108	86060548	Rat
631688	Hcas2	Hepatocarcinoma susceptibility QTL 2	3	0.0001	liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	5925874	115540829	Rat
2313062	Bmd73	Bone mineral density QTL 73	3.9	0.0001	tibia mineral mass (VT:1000283)	compact volumetric bone mineral density (CMO:0001730)	1	11481312	82174945	Rat
2313065	Bss67	Bone structure and strength QTL 67	3.1	0.0001	tibia area (VT:1000281)	tibia total energy absorbed before break (CMO:0001736)	1	11481312	82174945	Rat
2313069	Bss68	Bone structure and strength QTL 68	2.9	0.0001	tibia size trait (VT:0100001)	tibia total energy absorbed before break (CMO:0001736)	1	11481312	82174945	Rat
2313075	Bss66	Bone structure and strength QTL 66	3.4	0.0001	tibia length (VT:0004357)	tibia length (CMO:0000450)	1	11481312	82174945	Rat
2313077	Bss69	Bone structure and strength QTL 69	3.5	0.0001	tibia strength trait (VT:1000284)	bone polar moment of inertia (CMO:0001558)	1	11481312	82174945	Rat
2313092	Bmd72	Bone mineral density QTL 72	2.5	0.0001	tibia mineral mass (VT:1000283)	total volumetric bone mineral density (CMO:0001728)	1	11481312	82174945	Rat
2313097	Bss70	Bone structure and strength QTL 70	3.5	0.0001	tibia strength trait (VT:1000284)	tibia total energy absorbed before break (CMO:0001736)	1	11481312	82174945	Rat
631495	Bp96	Blood pressure QTL 96	4.52		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	22340647	102268831	Rat
1358359	Sradr1	Stress Responsive Adrenal Weight QTL 1	4.74		adrenal gland mass (VT:0010420)	both adrenal glands wet weight (CMO:0000164)	1	30882023	123479925	Rat
70225	Bp58	Blood pressure QTL 58	3.3		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	32356093	162846471	Rat
1300172	Bp172	Blood pressure QTL 172	3.56		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	1	32737273	90665040	Rat
10059597	Bp377	Blood pressure QTL 377	3.42	0.025	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	32737458	199368955	Rat
8552900	Pigfal1	Plasma insulin-like growth factor 1 level QTL 1	7.4		blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	1	34836858	79836858	Rat
8552948	Pigfal11	Plasma insulin-like growth factor 1 level QTL 11	4.7		blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	1	34836858	79836858	Rat
9589820	Insglur3	Insulin/glucose ratio QTL 3	10.75	0.001	blood insulin amount (VT:0001560)	calculated plasma insulin level (CMO:0002170)	1	34836858	79836858	Rat
2313051	Bss57	Bone structure and strength QTL 57	3.7	0.0001	tibia strength trait (VT:1000284)	bone polar moment of inertia (CMO:0001558)	1	43284731	118944897	Rat
2313059	Bss55	Bone structure and strength QTL 55	3.2	0.0001	tibia size trait (VT:0100001)	tibia midshaft cross-sectional area (CMO:0001717)	1	43284731	118944897	Rat
2313072	Bss53	Bone structure and strength QTL 53	4.3	0.0001	tibia length (VT:0004357)	tibia length (CMO:0000450)	1	43284731	118944897	Rat
2313078	Bss54	Bone structure and strength QTL 54	3.5	0.0001	tibia area (VT:1000281)	tibia midshaft cross-sectional area (CMO:0001717)	1	43284731	118944897	Rat
2313094	Bss58	Bone structure and strength QTL 58	3.7	0.0001	tibia strength trait (VT:1000284)	tibia total energy absorbed before break (CMO:0001736)	1	43284731	118944897	Rat
2313098	Bmd70	Bone mineral density QTL 70	3.6	0.0001	tibia mineral mass (VT:1000283)	compact volumetric bone mineral density (CMO:0001730)	1	43284731	118944897	Rat
2313099	Bss56	Bone structure and strength QTL 56	2.4	0.0001	tibia size trait (VT:0100001)	tibia midshaft endosteal cross-sectional area (CMO:0001716)	1	43284731	118944897	Rat
2302059	Pia36	Pristane induced arthritis QTL 36	3.8	0.001	blood immunoglobulin amount (VT:0002460)	serum immunoglobulin G1 level (CMO:0002115)	1	43333002	88333002	Rat
2313402	Anxrr24	Anxiety related response QTL 24			aggression-related behavior trait (VT:0015014)	tameness/aggressiveness composite score (CMO:0002136)	1	48963584	144267916	Rat
4889962	Bss94	Bone structure and strength QTL 94	3.8		tibia area (VT:1000281)	tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)	1	49361465	82174945	Rat
1578649	Bmd8	Bone mineral density QTL 8	4.9		femur mineral mass (VT:0010011)	trabecular volumetric bone mineral density (CMO:0001729)	1	49393172	94393172	Rat
1578654	Bss10	Bone structure and strength QTL 10	4		femur morphology trait (VT:0000559)	femoral neck cortical cross-sectional area (CMO:0001702)	1	49393172	159356837	Rat
634314	Niddm44	Non-insulin dependent diabetes mellitus QTL 44			blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	49393289	199050459	Rat
6903308	Scl36	Serum cholesterol QTL 36	2	0.0125	blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	1	53863041	90532583	Rat
4889919	Bss86	Bone structure and strength QTL 86	4.1		tibia area (VT:1000281)	tibia midshaft total cross-sectional area (CMO:0001715)	1	53895117	82174945	Rat
4889929	Bss87	Bone structure and strength QTL 87	6.7		tibia area (VT:1000281)	tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)	1	53895117	82174945	Rat
61342	Bp27	Blood pressure QTL 27	3.4	0.0006	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	56732668	98773277	Rat
2300164	Bmd44	Bone mineral density QTL 44	5.4	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	1	56949932	101949932	Rat
2298545	Neuinf8	Neuroinflammation QTL 8	4.6		nervous system integrity trait (VT:0010566)	spinal cord beta-2 microglobulin mRNA level (CMO:0002125)	1	57336763	151090257	Rat
1300121	Hrtrt1	Heart rate QTL 1	3.7		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	1	65789093	115540829	Rat
7421628	Bp361	Blood pressure QTL 361		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	66023617	118608521	Rat
631512	Scl6	Serum cholesterol level QTL 6	9.6		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	1	72197680	90508767	Rat
1358192	Ept13	Estrogen-induced pituitary tumorigenesis QTL 13	3.4		pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	1	77494165	122494165	Rat
10054135	Gmadr2	Adrenal mass QTL 2	1.97	0.0129	adrenal gland mass (VT:0010420)	both adrenal glands wet weight (CMO:0000164)	1	77857876	122857876	Rat
1549903	Bp267	Blood pressure QTL 267			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	77876254	106047988	Rat
61344	Bp29	Blood pressure QTL 29	7.5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	78350581	123350581	Rat
7411712	Strs4	Sensitivity to stroke QTL 4	8.7		cerebrum integrity trait (VT:0010549)	percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932)	1	78430536	123430536	Rat
61433	Cia2	Collagen induced arthritis QTL 2	5		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	1	78430754	91209302	Rat
1582234	Gluco18	Glucose level QTL 18	3.4	0.0003	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	78479925	123479925	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
UniSTS	122612	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: DXRat53