D6Rat1 Marker Search Result - Rat Genome Database

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes Community Projects (beta) QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

General

Marker: D6Rat1

Symbol:

D6Rat1

Previously known as:

R0048-C11; oxsts7250; R048-C11;

RGD ID:

37076

Expected Size:

232 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	6	137,801,573 - 137,801,795 (+)	MAPPER	mRatBN7.2
Rnor_6.0	6	144,745,354 - 144,745,573	NCBI	Rnor6.0
Rnor_5.0	6	153,671,821 - 153,672,040	UniSTS	Rnor5.0
RGSC_v3.4	6	144,152,353 - 144,152,572	UniSTS	RGSC3.4
RGSC_v3.4	6	144,152,352 - 144,152,572	RGD	RGSC3.4
RGSC_v3.1	6	144,158,540 - 144,158,759	RGD
Celera	6	135,457,174 - 135,457,393	UniSTS
RH 3.4 Map	6	924.0	RGD
RH 3.4 Map	6	924.0	UniSTS
RH 2.0 Map	6	1203.5	RGD
SHRSP x BN Map	6	82.8898	RGD
FHH x ACI Map	6	95.64	RGD
Cytogenetic Map	6	q33	UniSTS

Is Marker For:

Strains: ACI/N AVN/Orl BBDR/Rhw BC/CpbU BDIX/Han BDVII/Cub BN-Lx/Cub BP/Cub BUF/Pit COP/OlaHsd DA/PitN FHH/Eur F344/Pit GH/Omr DON/Melb M520/N IS/Kyo WN/N LH/Mav LE/Mol LEW/Pit LOU/CHan LN/Mav MHS/Gib MNR/N MNRA/N MNS/Gib MR/Pit NEDH/K NP9 ODU/N OKA/Wsl OM/Ztm P5C PVG/Pit SD/Rij SHR/OlaHsd SR/Jr SHRSP/Riv SS/Jr WAG/RijKyo WF/Pit WIST/Nhg WKY/OlaHsd WTC/Kyo MWF.SHR-(D6Rat1-D6Rat81)/Rkb MWF.SHR-(D6Rat1-D6Rat184)/Rkb MWF.SHR-(D6Rat1-D6Rat30)/Rkb MWF.SHR-(D6Rat1-D6Rat106)/Rkb MWF.SHR-(D6Rat1-D6Mit8)/Rkb MWF.SHR-(D6Rat1-D6Rat121)/Rkb MWF.SHR-(D6Rat1-D6Mgh4)/Rkb MWF.SHR-(D6Rat1-D6Rat115)/Rkb
QTLs: Colcr5 Iddm29 Pur20
Genes: Ptprn2

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.	Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3.	Rat Genetic Map Data	Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4.	Electronic Transfer of SSLP Data	Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5.	UniSTS Pipeline	RGD automated pipelines
6.	RH Map Project	RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7.	A high density integrated genetic linkage and radiation hybrid map of the laboratory rat	Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence


Forward Primer	CGCTGTCTCCTCTTCATTCC
Reverse Primer	GACACAGACACAGTCCCCCT

Template	TGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCTAAGAACTCCTTGACGTTGTTGTTCCTGGT AAGGGTCCCTTCTGCAGACACAGACACAGTCCCCCTGGAGCACCTGCTAGTCACTGTGCTCTGG CCATTGGCATCTGCCAGGCATTGTCCAGTTGTGCTCTCTCTCTCTCTCNCTCTTNNNTNTNCTC TCTCTCTCCCTCTCCCTGCCTCCTGACACACACACACACACACACACACACACACACACACACA CACACACACAGAGTCTTTAGATCATGGGAATGAAGAGGAGACAGCGACAGGGGTACCGAGCTCG AATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACA ACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATT AATTGCGTCGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGA ATCGGCCAACGCGCGGGGAGAGGCGGTNTGCGTATTGGGCGCCAGGGTGGTTTTNCTTTTCACA GTGAGAGNGCAAANCTGATNCCCTTCACGNNGGNCTGAGAGAGTTGCAGNAGNGTCANT

Strain Variation

Strain, Expected Size(s)

ACI/N	230
AVN/Orl	224
BBDR/Rhw	220
BC/CpbU	230
BDIX/Han	226
BDVII/Cub	220
BN-Lx/Cub	220
BP/Cub	230
BUF/Pit	224
COP/OlaHsd	224
DA/PitN	230
DON/Melb	224

F344/Pit	224
FHH/Eur	224
GH/Omr	230
IS/Kyo	224
LE/Mol	228
LEW/Pit	224
LH/Mav	226
LN/Mav	230
LOU/CHan	220
M520/N	224
MHS/Gib	220
MNR/N	226

MNRA/N	226
MNS/Gib	236
MR/Pit	226
NEDH/K	234
NP9	220
ODU/N	224
OKA/Wsl	224
OM/Ztm	230
P5C	234
PVG/Pit	224
SD/Rij	230
SHR/OlaHsd	224

SHRSP/Riv	230
SR/Jr	226
SS/Jr	230
WAG/RijKyo	224
WF/Pit	232
WIST/Nhg	232
WKY/OlaHsd	224
WN/N	230
WTC/Kyo	224

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
61904	Ptprn2	protein tyrosine phosphatase, receptor type N2	6	137439572	138191575	Rat

Nucleotide Sequences


GenBank Nucleotide	CH474038	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CM000236	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
731173	Uae22	Urinary albumin excretion QTL 22	10.1		urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	6	65531555	140994061	Rat
2290393	Uae37	Urinary albumin excretion QTL 37		0.0001	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	6	65531555	140994061	Rat
61414	Pia3	Pristane induced arthritis QTL 3	4.5		joint integrity trait (VT:0010548)	post-insult time to onset of experimental arthritis (CMO:0001450)	6	94968928	137848904	Rat
12801411	Schws8	Schwannoma susceptibility QTL 8			nervous system integrity trait (VT:0010566)	percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)	6	94968928	139968928	Rat
8552796	Vie3	Viral induced encephalitis QTL 3	2.6		brain integrity trait (VT:0010579)	encephalitis incidence/prevalence measurement (CMO:0002361)	6	96833997	140994061	Rat
1358355	Srcrt4	Stress Responsive Cort QTL 4	6.39		blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	6	100364669	140994061	Rat
71111	Iddm8	Insulin dependent diabetes mellitus QTL 8	1.9	0.002	blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	6	105156861	140994061	Rat
737976	Pia24	Pristane induced arthritis QTL 24			joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	6	112636280	140994061	Rat
1641917	Colcr5	Colorectal carcinoma resistance QTL 5	3.18	0.0009	intestine integrity trait (VT:0010554)	benign colorectal tumor number (CMO:0001795)	6	122549046	137801795	Rat
2293085	Iddm29	Insulin dependent diabetes mellitus QTL 29	7.66		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	6	122549046	140286318	Rat
61329	Eae9	Experimental allergic encephalomyelitis QTL 9	3.7		body mass (VT:0001259)	change in body weight (CMO:0002045)	6	122549046	140994061	Rat
2312560	Pur20	Proteinuria QTL 20	2.1	0.005	urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	6	125628133	137801795	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	100302911	UniSTS
	100302928	UniSTS
	100303440	UniSTS
	29714	UniSTS
UniSTS	118945	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D6Rat1