D17Rat42 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D17Rat42

Symbol: D17Rat42
Previously known as: oxsts6381; R048-B10; R0048-B10; 
RGD ID: 37068
Expected Size: 141 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81776,124,449 - 76,124,590 (+)Marker Load Pipeline
mRatBN7.21771,214,977 - 71,215,120 (+)MAPPERmRatBN7.2
Rnor_6.01775,066,079 - 75,066,219NCBIRnor6.0
Rnor_5.01776,722,365 - 76,722,505UniSTSRnor5.0
RGSC_v3.41782,505,421 - 82,505,562RGDRGSC3.4
RGSC_v3.41782,505,422 - 82,505,562UniSTSRGSC3.4
RGSC_v3.11782,516,255 - 82,516,395RGD
Celera1770,674,130 - 70,674,270UniSTS
RH 3.4 Map17695.3RGD
RH 3.4 Map17695.3UniSTS
RH 2.0 Map17605.7RGD
SHRSP x BN Map1740.3299RGD
Is Marker For: Strains:   ACI/N   AVN/Orl   BBDR/Rhw   BBDP/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN-Lx/Cub   BP/Cub   COP/OlaHsd   FHH/Eur   F344/Pit   GH/Omr   GK/KyoSwe   DON/Melb   M520/N   IS/Kyo   WN/N   LH/Mav   LE/Mol   LEW/Pit   LOU/CHan   LN/Mav   MHS/Gib   MNRA/N   MNS/Gib   MR/Pit   NEDH/K   NP9   ODU/N   OKA/Wsl   OM/Ztm   P5C   SD/Rij   SHR/OlaHsd   SR/Jr   SHRSP/Riv   SS/Jr   WAG/RijKyo   WF/Pit   WIST/Nhg   WKY/OlaHsd   WTC/Kyo  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Genome-wide linkage analysis of inherited hydrocephalus in the H-Tx rat. Jones HC, etal., Mamm Genome 2001 Jan;12(1):22-6.
3. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
4. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
5. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
6. UniSTS Pipeline RGD automated pipelines
7. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
8. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer TGCCGCTATTAAAAAGTAACTGC
Reverse Primer CCAAAGGCATAAAAATCTTTCC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
68347Celf2CUGBP, Elav-like family member 2177090446271729072Rat

Nucleotide Sequences
GenBank Nucleotide CH473990 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000247 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1358295Aocep1Aortic cell protein QTL 16.17e-07thoracic aorta cellular protein amount (VT:0010598)aortic cell percentage174099000585990005Rat
152023626Bp403Blood pressure QTL 4033.86arterial blood pressure trait (VT:2000000)172393042179524188Rat
7411575Bw140Body weight QTL 14030.20.001body mass (VT:0001259)body weight gain (CMO:0000420)174856093586533673Rat
2301412Kidm40Kidney mass QTL 400.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)173747984782479847Rat
631502Cm26Cardiac mass QTL 263.71heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)176570358081153923Rat
1354588Bvd4Brain ventricular dilatation QTL 45.310.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)175349882882479847Rat
7411577Bw141Body weight QTL 1410.001body mass (VT:0001259)body weight gain (CMO:0000420)176261951686533673Rat
9590107Sffal7Serum free fatty acids level QTL 74.810.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)172840914773409147Rat
2317038Ginf3Gastrointestinal inflammation QTL 32.890.005liver integrity trait (VT:0010547)liver granuloma severity score (CMO:0002157)174992015486533673Rat
724549Niddm56Non-insulin dependent diabetes mellitus QTL 560.03blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)173199078476990784Rat
1598871Memor5Memory QTL 55.3exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)174054004180387013Rat
2317045Aia11Adjuvant induced arthritis QTL 114.06joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)176078142686533673Rat
152025238Slep14Serum leptin concentration QTL 144.62blood leptin amount (VT:0005667)172418489079524188Rat
2317054Aia12Adjuvant induced arthritis QTL 124.24joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)173828150983281509Rat
8694181Bw151Body weight QTL 1514.360.001body mass (VT:0001259)body weight gain (CMO:0000420)174856093586533673Rat
8552928Pigfal9Plasma insulin-like growth factor 1 level QTL 99blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)172840914773409147Rat
1300148Bp192Blood pressure QTL 1923.47arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)173455084373951021Rat
2317060Aia26Adjuvant induced arthritis QTL 263.22joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)173828150983281509Rat
4889894Eae33Experimental allergic encephalomyelitis QTL 335.20.0001nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)175090909986022412Rat
2324621Coatc5Coat color QTL 5coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)173136839173951021Rat
1300131Bp193Blood pressure QTL 1933.3arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)176364000973951021Rat
7488963Bp369Blood pressure QTL 3690.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)175900564977910000Rat
1300129Rf25Renal function QTL 253.03blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)177100332581153923Rat
152023740Bp406Blood pressure QTL 4066.06arterial blood pressure trait (VT:2000000)172393042179524188Rat
1354663Bvd5Brain ventricular dilatation QTL 53.510.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)173199078481292925Rat
152023737Bp405Blood pressure QTL 4055.06arterial blood pressure trait (VT:2000000)2393042179524188Rat
152023736Bp404Blood pressure QTL 4043.78arterial blood pressure trait (VT:2000000)172393042179524188Rat
2302365Gluco40Glucose level QTL 404.79blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)175724684382046127Rat
2303580Gluco49Glucose level QTL 492blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)175004027186533673Rat


Additional Information