D3Rat147 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D3Rat147

Symbol: D3Rat147
Previously known as: oxsts10689; R0032-D03; 
RGD ID: 36223
Expected Size: 168 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr83162,077,160 - 162,077,328 (+)Marker Load Pipeline
mRatBN7.23141,616,923 - 141,617,091 (+)MAPPERmRatBN7.2
Rnor_6.03148,625,254 - 148,625,421NCBIRnor6.0
Rnor_5.03155,027,757 - 155,027,924UniSTSRnor5.0
RGSC_v3.43143,492,425 - 143,492,830RGDRGSC3.4
RGSC_v3.43143,492,509 - 143,492,676UniSTSRGSC3.4
Celera3140,363,930 - 140,364,096UniSTS
RGSC_v3.13143,398,131 - 143,398,298RGD
RH 3.4 Map31264.8UniSTS
RH 3.4 Map31264.8RGD
RH 2.0 Map3842.9RGD
SHRSP x BN Map365.2999RGD
Is Marker For: Strains:   ACI/N   AVN/Orl   BBDR/Rhw   BBDP/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN-Lx/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   COP/OlaHsd   DA/PitN   FHH/Eur   F344/Pit   GH/Omr   GK/KyoSwe   DON/Melb   M520/N   IS/Kyo   WN/N   LH/Mav   LE/Mol   LEW/Pit   LOU/CHan   LN/Mav   MHS/Gib   MNR/N   MNRA/N   MNS/Gib   MR/Pit   NEDH/K   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SR/Jr   SHRSP/Riv   SS/Jr   WAG/RijKyo   WF/Pit   WIST/Nhg   WKY/OlaHsd   WTC/Kyo  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer TGCTCACATGTGTACCTCACA
Reverse Primer GGCCAAAAACATGTGGGTAA
 
Template
CATCCCCCTACGCTTGGTGTCAACCTAAAGGCTGCTCCAGGTTCGTCCCTCAGTCACTTATTTT
CCTTGGACCACATCCTAATCAGGGAGGAAGGCTGGAGGGTAAGAGCAGAAACAACATTCTAAAT
TTCGGTTTCCTCCACTTTTGCTAACGTTCTATTGGCCAAAAACATGTGGGTAAGTTGTGTGTGT
GTGTGTGTGTGTGTGTGTGTGTACAATTATAAATATAAGGTATACATGTAAGCATGTATGTATT
ATAGGGTGATGCTGTGTGATGTGTGTGTACAATTGTAAGTGTGAGGTACACATGTGAGCATGTT
TATATTATAGGTGACACTGGTTTTAGATTTTGTTCATGGTTCCTGTTTTATAACTTCCTCCTCC
AGTCAGGTATAAAAGGGGTACCGAGCTCGAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTG
AAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGANGCATAAAGTGTAAAGCCTGG
GGTGCCTAATGAGTGAGCTACTCANTTAATTGCGTTGCGCCACTGNC

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
7634195LOC102554664uncharacterized LOC1025546643162075077162087574Rat

Nucleotide Sequences
GenBank Nucleotide JH614345.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
12879876Bw182Body weight QTL 1820.003body mass (VT:0001259)body weight (CMO:0000012)3141555229186555229Rat
2301411Bp320Blood pressure QTL 3200.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)3141555229186555229Rat
1582233Insul10Insulin level QTL 105.40.0015blood insulin amount (VT:0001560)serum insulin level times blood glucose level (CMO:0002040)3133259579178259579Rat
12879872Cm97Cardiac mass QTL 970.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)3141555229186555229Rat
12879873Cm96Cardiac mass QTL 960.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)3141555229186555229Rat
1578653Vnigr3Vascular neointimal growth QTL 33.1artery morphology trait (VT:0002191)artery neointimal hyperplastic lesion area (CMO:0001414)3151075912189428310Rat
2302373Gluco39Glucose level QTL 395.01blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)3129154923182114333Rat
12879874Cm98Cardiac mass QTL 980.005heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)3141555229186555229Rat
12879875Kidm64Kidney mass QTL 640.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)3141555229186555229Rat
1298068Bp167Blood pressure QTL 1670.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3161492708189428310Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)351581665184004958Rat
2292591Esta4Estrogen-induced thymic atrophy QTL 4thymus mass (VT:0004954)thymus wet weight (CMO:0000855)367641776167835660Rat
61335Bp20Blood pressure QTL 203arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3161799493176036425Rat
1578754Stresp16Stress response QTL 1640.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)3133134628178134628Rat
1331726Bp208Blood pressure QTL 2083.129arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)3161799270187311134Rat
1582213Insul6Insulin level QTL 63.70.0009blood insulin amount (VT:0001560)calculated serum insulin level (CMO:0000359)3155759447189428310Rat
1300173Rf11Renal function QTL 113.38renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)3141508991166376254Rat
9589106Insul23Insulin level QTL 2313.860.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)3152055202189428310Rat
10755461Coatc16Coat color QTL 16coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)3142898802187898802Rat
8662816Vetf4Vascular elastic tissue fragility QTL 44renal artery integrity trait (VT:0010642)number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563)379649560177741895Rat
1559282Emca5Estrogen-induced mammary cancer QTL 53.9mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)3145335553189428310Rat
1354611Despr2Despair related QTL 23.030.0028locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)3117537367162537367Rat
2303620Vencon4Ventilatory control QTL 43.9respiration trait (VT:0001943)tidal volume (CMO:0000222)3125116475170116475Rat
1582256Insul9Insulin level QTL 94.40.0016blood insulin amount (VT:0001560)absolute change in serum insulin level (CMO:0002038)3155759447189428310Rat
1576306Schws3Schwannoma susceptibility QTL 30.001nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)3139299381184299381Rat
5686842Rf59Renal function QTL 59urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)3122395989167395989Rat
1300159Kidm4Kidney mass QTL 43.83kidney mass (VT:0002707)right kidney wet weight to body weight ratio (CMO:0001953)3141508991177728348Rat
2301971Cm71Cardiac mass QTL 714.63heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)3131036586176036586Rat
631673Iddm13Insulin dependent diabetes mellitus QTL 131.30.663blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)3137114333182114333Rat
1582248Insul7Insulin level QTL 73.90.0041blood insulin amount (VT:0001560)calculated serum insulin level (CMO:0000359)3155759447189428310Rat
2301970Bw81Body weight QTL 815.19body mass (VT:0001259)body weight (CMO:0000012)3131036586176036586Rat
1581546Pur13Proteinuria QTL 132.930.0335urine total protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)398651826167012663Rat
1578666Vnigr1Vascular neointimal growth QTL 14.6artery morphology trait (VT:0002191)artery lumen area (CMO:0001409)3151075912189428310Rat
1578656Vnigr2Vascular neointimal growth QTL 24.2artery morphology trait (VT:0002191)lesioned artery residual lumen area (CMO:0001417)3151075912189428310Rat
12879871Am7Aortic mass QTL 70.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)3141555229186555229Rat
631541Bp81Blood pressure QTL 814arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3144575244189428310Rat
2293087Iddm27Insulin dependent diabetes mellitus QTL 272.68blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)3160357340167835660Rat


Additional Information