D1Rat32 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Rat32

Symbol: D1Rat32
Previously known as: R0023-C09; oxsts6666; R023-C09; 
RGD ID: 35741
Expected Size: 165 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01195,598,053 - 195,598,217NCBIRnor6.0
Rnor_5.01202,649,657 - 202,649,821UniSTSRnor5.0
RGSC_v3.41112,148,733 - 112,149,024RGDRGSC3.4
RGSC_v3.41112,148,806 - 112,148,970UniSTSRGSC3.4
RGSC_v3.11112,227,076 - 112,227,367RGD
Celera1105,238,688 - 105,238,852UniSTS
RH 3.4 Map1907.99UniSTS
RH 3.4 Map1907.99RGD
SHRSP x BN Map153.8299RGD
SHRSP x BN Map153.8299UniSTS
FHH x ACI Map155.58RGD
Cytogenetic Map1 RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   WKY.GHS-(D1Rat32-D1Mit32)   DA.PVG.1AV1-(D1Rat32-D1Rat51)/Kini  
QTLs:   Hc6  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer TGAGCCATTGAGTTGTGAGC
Reverse Primer TGTTTTCCAAATGAAGCGTG
 
Template
TGNGTCGACTCTAGAGGATCCCCACGTAATAATTTGAGAATATCTGAAGGAGGTGAATATAAAG
ATTAGGAAGTGACTGAGCCATTGAGTTGTGAGCTGTGAGCTCTTCTAGGCATATCAATATATAA
AGGATCTCTCTCTCTCTGTCTCTGTCTCTGTCTCTGTCTCTCTCTCTCTCTGTGTGTGTGTGTG
TGTGTGTGTGTTTGTGTGTTTGTGTGTGTGTGTGCACGCTTCATTTGGAAAACAGAACATTAGG
ATGGGTAGCAAGAAACGTGTGGCTGCCACCAAGGCTGCCACCAAGATTTTTTTTAATTCGGTGG
GTACCGAGCTCGAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCA
CAATTCCACACAACATACGNGCCGGAAGCATAAAGTGTAAAGCCTGGGGNGCCTAANGAGTGAG
CT

Region

Nucleotide Sequences
GenBank Nucleotide CH474113.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100302894 UniSTS
UniSTS 120341 UniSTS