D10Rat59 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D10Rat59

Symbol: D10Rat59
Previously known as: oxsts5991; R019-D04; R0019-D04; 
RGD ID: 35529
Expected Size: 146 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81053,456,215 - 53,456,361 (+)Marker Load Pipeline
mRatBN7.21052,957,296 - 52,957,442 (+)MAPPERmRatBN7.2
Rnor_6.01054,816,216 - 54,816,361NCBIRnor6.0
Rnor_5.01054,561,755 - 54,561,900UniSTSRnor5.0
RGSC_v3.41055,004,338 - 55,004,484RGDRGSC3.4
RGSC_v3.41055,004,339 - 55,004,484UniSTSRGSC3.4
Celera1052,132,256 - 52,132,401UniSTS
RGSC_v3.11055,017,915 - 55,018,228RGD
FHH x ACI Map1042.61UniSTS
FHH x ACI Map1042.61RGD
Cytogenetic Map10q24UniSTS
Is Marker For: Strains:   AVN/Orl   BBDR/Rhw   BBDP/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN-Lx/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   COP/OlaHsd   DA/PitN   FHH/Eur   F344/Pit   GH/Omr   GK/KyoSwe   DON/Melb   M520/N   IS/Kyo   WN/N   LH/Mav   LE/Mol   LEW/Pit   LOU/CHan   LN/Mav   MHS/Gib   MNR/N   MNRA/N   MNS/Gib   MR/Pit   NEDH/K   NP9   ODU/N   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SR/Jr   SHRSP/Riv   SS/Jr   WAG/RijKyo   WF/Pit   WIST/Nhg   WKY/OlaHsd   WTC/Kyo  
Genes:   Ntn1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CAGAACCTTGACCCACACAG
Reverse Primer TAGCCCTTGGCTTTCTAGCA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
619809Ntn1netrin 1105339885253597595Rat

Nucleotide Sequences
GenBank Nucleotide CH473948 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000240 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61441Btemp1Thermal response to stress QTL 14body temperature trait (VT:0005535)core body temperature (CMO:0001036)103589345164140567Rat
1549846Scl47Serum cholesterol level QTL 473.6blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)105107189796071897Rat
152025229Scl83Serum cholesterol level QTL 834.33blood cholesterol amount (VT:0000180)103621155669161158Rat
1578779Tcas10Tongue tumor susceptibility QTL 103.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)103179628176796281Rat
152025227Bw195Body weight QTL 1955.73body mass (VT:0001259)104748901769161158Rat
631564Apr3Acute phase response QTL 33.9blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)101577675460776754Rat
1298069Bp168Blood pressure QTL 1685.5blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)102702353598502431Rat
2293669Bmd33Bone mineral density QTL 334.50.0001femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)102744378772443787Rat
152025224Bw193Body weight QTL 1936.47body mass (VT:0001259)105216243375582749Rat
631552Vetf2Vascular elastic tissue fragility QTL 24.50.0002aorta elastic tissue integrity trait (VT:0010556)artery internal elastic lamina non-tumorous lesion count (CMO:0001913)103550938391417879Rat
631554Bp133Blood pressure QTL 1330.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)10125055464349221Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023948641107713808Rat
2293679Bmd30Bone mineral density QTL 303.50.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)102744378772443787Rat
1298078Stresp5Stress response QTL 52.990.00025blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1042546145107713808Rat
1578762Toxo1Toxoplasma gondii resistance QTL 1brain integrity trait (VT:0010579)percentage of study population displaying Toxoplasma gondii brain cysts at a point in time (CMO:0002028)105269900459876693Rat
2298544Neuinf9Neuroinflammation QTL 94.6nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)101993920764939207Rat
61332Eau3Experimental allergic uveoretinitis QTL 30.004uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)101803578263035782Rat
61463Bp12Blood pressure QTL 126.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)104183127886831278Rat
1579919Bp281Blood pressure QTL 2810.01arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)105046480295464802Rat
8694173Bw149Body weight QTL 1494.380.001body mass (VT:0001259)body weight gain (CMO:0000420)104493935989939359Rat
2300218Hpcl2Hepatic cholesterol level QTL 2liver cholesterol amount (VT:0010498)liver cholesterol level (CMO:0001597)104552916496099749Rat
1598852Anxrr19Anxiety related response QTL 195.07body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)101866841963668419Rat
1581497Esta1Estrogen-induced thymic atrophy QTL 1thymus mass (VT:0004954)thymus wet weight (CMO:0000855)102183375861843633Rat
10450493Bp382Blood pressure QTL 3820.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)105086028895860288Rat
724527Bp148Blood pressure QTL 1480.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102895035373950353Rat
1358897Stresp6Stress response QTL 64.170.022blood norepinephrine amount (VT:0005663)plasma norepinephrine level (CMO:0001010)103589326364653589Rat
1331762Rf40Renal function QTL 403.873kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)102980091064653589Rat
2300171Bmd58Bone mineral density QTL 584.90.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)102744378772443787Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023948641107713808Rat
2301967Cm73Cardiac mass QTL 734.55heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)101499153586964295Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)14282327487823274Rat
9589030Epfw9Epididymal fat weight QTL 919.240.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)104493935989939359Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014991535107556066Rat
2293652Bmd22Bone mineral density QTL 224.90.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)102744378772443787Rat
70198BpQTLcluster9Blood pressure QTL cluster 92.94arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)104282327487823274Rat
724556Pur2Proteinuria QTL 25.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)102293137391127454Rat
8662860Vetf10Vascular elastic tissue fragility QTL 10artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)10666092373950353Rat
2306792Ean4Experimental allergic neuritis QTL 44nervous system integrity trait (VT:0010566)IFNG-secreting splenocyte count (CMO:0002122)104949549294495492Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1052269185107713808Rat
70223Bp57Blood pressure QTL 575arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)101465354159653541Rat
1354587Kidm21Kidney mass QTL 213.3kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)101553301273695498Rat
634329Pia15Pristane induced arthritis QTL 153.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)102466212373695339Rat
70224Eae3Experimental allergic encephalomyelitis QTL 34.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)102702353561843633Rat
2298480Eau7Experimental allergic uveoretinitis QTL 70.0049uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)103550938380509383Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)102980091091417879Rat
2298495Eae23Experimental allergic encephalomyelitis QTL 2316.93nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis duration (CMO:0001424)101617552561175525Rat
2313087Bmd80Bone mineral density QTL 803.20.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)102011061465110614Rat
631530Tls3T-lymphoma susceptibility QTL 300.0001thymus integrity trait (VT:0010555)percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)102758722696099902Rat
2289985Bp305Blood pressure QTL 305arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)102907697874076978Rat
631532Cm50Cardiac mass QTL 506.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)101803578263035782Rat
8552805Bw145Body weight QTL 1452.2body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)104360879388608793Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023948641107713808Rat
2293705Bmd25Bone mineral density QTL 257.10.0001femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)102744378772443787Rat
631269Cia22Collagen induced arthritis QTL 228.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040535708107713808Rat
1576308Schws1Schwannoma susceptibility QTL 10.0041nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)1040535708107713808Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014991535107713808Rat
7207811Bmd90Bone mineral density QTL 905.2femur size trait (VT:1000369)femoral neck cross-sectional area (CMO:0001697)104994371094943710Rat
1576311Pia26Pristane induced arthritis QTL 26joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103112911376129113Rat
631270Cia23Collagen induced arthritis QTL 233.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040535708107713808Rat
7411614Foco18Food consumption QTL 180.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)104493935989939359Rat
631547Bp87Blood pressure QTL 874.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)104786912992869129Rat
61427Cia16Collagen induced arthritis QTL 163.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10686461896620484Rat
12880050Am10Aortic mass QTL 100.016aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)103950348784503487Rat
2292436Bp310Blood pressure QTL 310arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)105060467795604677Rat
6893342Cm78Cardiac mass QTL 780.10.88heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)103550938388177745Rat
2313055Bw96Body weight QTL 963.60.0001body mass (VT:0001259)body weight (CMO:0000012)102011061465110614Rat
631542Bp82Blood pressure QTL 826.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)102702353599451848Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 114523 UniSTS