D14Rat23 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D14Rat23

Symbol: D14Rat23
Previously known as: R0003-D08; oxsts6204; R003-D08; 
RGD ID: 34981
Expected Size: 168 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2141,217,606 - 1,217,776 (+)MAPPERmRatBN7.2
Rnor_6.0142,227,825 - 2,227,992NCBIRnor6.0
Rnor_5.0142,222,207 - 2,222,374UniSTSRnor5.0
RGSC_v3.4141,764,386 - 1,764,554RGDRGSC3.4
RGSC_v3.4141,764,387 - 1,764,554UniSTSRGSC3.4
RGSC_v3.1141,764,386 - 1,764,554RGD
Celera141,256,962 - 1,257,129UniSTS
RH 2.0 Map140.0RGD
FHH x ACI Map141.33RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   F344.OLETF-(D14Rat23-D14Rat12)/Tj   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   F344.ZUC-Leprfa(D14Rat23-D14Rat12)/Tj   F344.OLETF-(D14Rat23-D14Rat55)/Tj   F344.OLETF-(D14Rat23-D14Rat5)/Tj   F344.OLETF-(D14Rat23-D14Rat10)/Tj   F344.OLETF-(D14Rat23-D14Wox14)/Tj   F344.OLETF-(D14Rat23)/Tj   F344.ZUC-(Leprfa),OLETF-(D14Rat23-D14Rat12)/Tj  
QTLs:   Niddm20   Niddm15  


Annotation



Strains and Sequence

Sequence
 
Forward Primer TCGGAGGGAGTGACACATAA
Reverse Primer TGTCCCTCAGTTCAGAATACCC
 
Template
CAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCACTGAGCAGTGGGATCAGGAATTGA
TATACGTAAGTGGTATGGTGGCTGTCGGAGGGAGTGACACATAAGTCAAGAAGATAGGTGGCAG
GAGCCATGTGGTCATATTCTCTCCCTCCTTCCCGACACCCGTGTGTGTGTGTGTGTGTGTGTGT
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTGGTGTGTGTGTGGGTATTCTGAACTGAGGGACA
GGTGGGTACCGAGCTCGAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCC
GCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGA
GTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGT
GCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCC

Region

Nucleotide Sequences
GenBank Nucleotide AC099280 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2300159Bmd61Bone mineral density QTL 615.30.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14126541967Rat
2300183Bmd60Bone mineral density QTL 605.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14126541967Rat
619619Rf4Renal disease susceptibility QTL 44.10.002urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)14132754612Rat
634352Apr6Acute phase response QTL 63.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)14141131407Rat
71115Niddm15Non-insulin dependent diabetes mellitus QTL 154.8blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)14121760611030812Rat
70204Niddm20Non-insulin dependent diabetes mellitus QTL 205.10.000008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)14121760616960180Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 326530 UniSTS
  326563 UniSTS
UniSTS 118364 UniSTS