D16Rat29 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D16Rat29

Symbol: D16Rat29
Previously known as: R0005-A09; oxsts6318; 
RGD ID: 34894
Expected Size: 139 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21646,053,354 - 46,053,497 (+)MAPPERmRatBN7.2
Rnor_6.01649,247,305 - 49,247,447NCBIRnor6.0
Rnor_5.01648,959,302 - 48,959,444UniSTSRnor5.0
RGSC_v3.41649,333,240 - 49,333,382UniSTSRGSC3.4
RGSC_v3.41649,333,239 - 49,333,382RGDRGSC3.4
RGSC_v3.11649,333,315 - 49,333,457RGD
Celera1644,051,987 - 44,052,129UniSTS
RH 3.4 Map16451.5RGD
RH 3.4 Map16451.5UniSTS
RH 2.0 Map16446.4RGD
SHRSP x BN Map1616.76RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Glom16  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer AAGGTGCGGTTACCAACATC
Reverse Primer GACACTTGAAATACAGAGGGGC
 
Template
TANANNCCCTGCAGTCACATATGCAGGCAGAATGCTGTACATAAAATAAATAAATAAATCTTTA
AAAAAAAAAAGTCACCACTCAGACTTGAAAGGTGCGGTTACCAACATCGTGTGTGTGTGTGTGT
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTACCCATGCACATGTGTATATCTATGAGCACTT
TTACTTTGTTTTAAGTAGCCCCTCTGTATTTCAAGTGTCCTAAAGAGAGCACACTTTAACATAT
GTCCCTGTGTAACACGGACAGTGAAGGCTGAAGTCTGCTTTCCACTGTAAGGTCCCCTATCTAG
GCAAAAGGTCAAATGCTCCAGAAGGGGGTACCGAGCTCGAATTCGTAATCATGNNCATAGCTGT
TTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTG
TAAAGCCTGGGGGTGCCTAATGAGTGNGCTAACTCACATTNATTGCGGTTGNCTCACNGNCCGC
TTTCCANGTNGGGAAACCTGNNGGTGCCANCTGNTTAATGAATCGGGCANCGCGCGGGGAGAAG
NGGTT

Region

Nucleotide Sequences
GenBank Nucleotide CH473995 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000246 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1683223646053497Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
737819Hcas4Hepatocarcinoma susceptibility QTL 44.43liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)16422760946975965Rat
61405Niddm6Non-insulin dependent diabetes mellitus QTL 63.660.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)16422760948972724Rat
61338Bp23Blood pressure QTL 234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760949227609Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
70215Niddm29Non-insulin dependent diabetes mellitus QTL 293.54blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)161900443575226532Rat
2302057Pia29Pristane induced arthritis QTL 293.60.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)162173597566735975Rat
8694453Bw172Body weight QTL 1728.330.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)162432551369325513Rat
6903294Stl30Serum triglyceride level QTL 302.60.0013blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)162515279370152793Rat
1298529Arunc1Aerobic running capacity QTL 14exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)163195152060148445Rat
1578768Stresp22Stress response QTL 222.8thymus mass (VT:0004954)thymus wet weight (CMO:0000855)163528887080288870Rat
2293690Bss45Bone structure and strength QTL 455.130.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)163775215682752156Rat
2300163Bmd64Bone mineral density QTL 645.30.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)163775215682752156Rat
7205510Activ5Activity QTL 53.780.00028locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)164239634584729064Rat
631833Sach2Saccharin preference QTL 240.01consumption behavior trait (VT:0002069)calculated saccharin drink intake rate (CMO:0001613)164302484250166018Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100302931 UniSTS
UniSTS 118420 UniSTS