D2Rat69 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D2Rat69

Symbol: D2Rat69
Previously known as: R0004-B06; oxsts6890; R004-B06; 
RGD ID: 34858
Expected Size: 147 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.02254,121,593 - 254,121,739NCBIRnor6.0
Rnor_5.02272,813,816 - 272,813,962UniSTSRnor5.0
RGSC_v3.42247,295,669 - 247,295,816RGDRGSC3.4
RGSC_v3.42247,295,670 - 247,295,816UniSTSRGSC3.4
RGSC_v3.12247,310,276 - 247,310,423RGD
Celera2229,879,373 - 229,879,519UniSTS
RH 2.0 Map21076.7RGD
SHRSP x BN Map2106.7499RGD
Cytogenetic Map2q45UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   BBDP.ACI-(D2Mit8-D2Rat69)/Sunn   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   BBDP.ACI-(D2Mit8-D2Arb16)(D2Rat354-D2Rat69)/Sunn   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Scl8   Bp175   Alcrsp17   Iddm33  
Genes:   Adgrl2  


Annotation



Strains and Sequence

Sequence
 
Forward Primer CTCCAGCTTTAGGGGAATCC
Reverse Primer TTGAAGGAGGAAAGGGACA
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473952 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000232 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 100303112 UniSTS
  100303287 UniSTS
  171447 UniSTS
  369083 UniSTS
  444925 UniSTS
UniSTS 118717 UniSTS