D13Rat19 Marker Search Result - Rat Genome Database

Send us a Message



 Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Community Projects (beta) QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap)  (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: D13Rat19

Symbol: D13Rat19
Previously known as: R0003-C03; oxsts6123; R003-C03; 
RGD ID: 34833
Expected Size: 169 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21611,442,912 - 11,443,111 (+)MAPPERmRatBN7.2
mRatBN7.21341,961,224 - 41,961,389 (+)MAPPERmRatBN7.2
Rnor_6.01347,227,759 - 47,227,923NCBIRnor6.0
Rnor_6.01612,747,329 - 12,747,527NCBIRnor6.0
Rnor_5.01352,281,936 - 52,282,100UniSTSRnor5.0
Rnor_5.01612,641,895 - 12,642,093UniSTSRnor5.0
RGSC_v3.41343,437,202 - 43,437,366UniSTSRGSC3.4
RGSC_v3.41343,437,201 - 43,437,366RGDRGSC3.4
RGSC_v3.41611,843,545 - 11,843,743UniSTSRGSC3.4
Celera1611,704,930 - 11,705,126UniSTS
Celera1342,313,047 - 42,313,211UniSTS
RH 3.4 Map13107.9RGD
RH 3.4 Map13107.9UniSTS
RH 2.0 Map13310.1RGD
SHRSP x BN Map1310.2499RGD
FHH x ACI Map1316.04RGD
Cytogenetic Map13q13UniSTS
Cytogenetic Map16p15UniSTS
Is Marker For: Strains:   ACI/N   AVN/Orl   BBDR/Rhw   BBDP/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN-Lx/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   COP/OlaHsd   DA/PitN   FHH/Eur   F344/Pit   GH/Omr   GK/KyoSwe   DON/Melb   M520/N   IS/Kyo   WN/N   LH/Mav   LE/Mol   LEW/Pit   LOU/CHan   LN/Mav   MHS/Gib   MNR/N   MNRA/N   MNS/Gib   MR/Pit   NEDH/K   NP9   ODU/N   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SR/Jr   SHRSP/Riv   SS/Jr   WAG/RijKyo   WF/Pit   WIST/Nhg   WTC/Kyo  
QTLs:   Eae17   Pur16  
Genes:   LOC363980   LOC683046   LOC364518   LOC100911139  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer TCAGAGCTCCATTAATCTGGATC
Reverse Primer GGGTGGAGGGGAATAAAGAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
41088786LOC120097483uncharacterized LOC120097483161139198711510903Rat
40999228Nono-ps7non-POU domain containing, octamer-binding, pseudogene 7161143979411443972Rat

Nucleotide Sequences
GenBank Nucleotide JH618610.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
738036Lnnr4Liver neoplastic nodule remodeling QTL 43.64liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)13142356786Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)131101056920Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131101056920Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131101056920Rat
61339Bp24Blood pressure QTL 240.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)13599466844807491Rat
1581554Pur11Proteinuria QTL 11urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat
1581573Uae36Urinary albumin excretion QTL 36urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat
1581570Eae17Experimental allergic encephalomyelitis QTL 174.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)138897350101631289Rat
7411662Foco29Food consumption QTL 2920.80.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)13931346554313465Rat
9589141Insul28Insulin level QTL 2810.820.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)13931346554313465Rat
2317040Aia21Adjuvant induced arthritis QTL 212.75joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)13983154154831541Rat
2317046Aia8Adjuvant induced arthritis QTL 83.9700000286102295joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)13983154154831541Rat
1300163Cardf1Cardiac cell morphology QTL 14.18aorta morphology trait (VT:0000272)artery lesion measurement (CMO:0000975)131192944945417941Rat
2302275Gluco37Glucose level QTL 373.8blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)131192944946193066Rat
631645Bp121Blood pressure QTL 1213.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131491565559915655Rat
9589164Gluco66Glucose level QTL 666.670.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)131515872260158722Rat
1331784Bp222Blood pressure QTL 2222.944arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131769443653050594Rat
7207885Glom27Glomerulus QTL 273.9kidney glomerulus integrity trait (VT:0010546)kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)1320605871101339738Rat
61391Bp5Blood pressure QTL 55.6arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)132230187567301875Rat
70170Eae14Experimental allergic encephalomyelitis QTL 140.0024nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)132320344868203448Rat
6893338Cm76Cardiac mass QTL 7600.99heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)132369296968692969Rat
1558644Cm45Cardiac mass QTL 453.60.002heart mass (VT:0007028)heart wet weight (CMO:0000069)132369296968692969Rat
1354621Rf47Renal function QTL 473.7kidney renin amount (VT:0010559)kidney renin level (CMO:0002166)1330395351101056920Rat
2301962Cm72Cardiac mass QTL 724.12heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)133124133158363171Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)133124133193395974Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133124133193395974Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)133124133193395974Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)133124133193395974Rat
2303563Bw89Body weight QTL 896body mass (VT:0001259)body weight (CMO:0000012)133228447177284471Rat
61340Bp25Blood pressure QTL 254.20.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133453521879535218Rat
2292232Pur16Proteinuria QTL 1617.2urine total protein amount (VT:0000032)urine protein level (CMO:0000591)133615572341961389Rat
12879477Bp401Blood pressure QTL 401arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)133726209282262092Rat
61349Bp31Blood pressure QTL 315.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)133737450982374509Rat
70220Bp55Blood pressure QTL 555.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)133737450982374509Rat
4889861Pur29Proteinuria QTL 2913.80.005urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)133741558480753406Rat
1331750Bp220Blood pressure QTL 2202.98arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)133741558482415584Rat
1549897Stresp12Stress response QTL 123.35stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)133843340883433408Rat
619615Bp80Blood pressure QTL 800.0354arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133975454484754544Rat
2303032Bp328Blood pressure QTL 328arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)134118402245417941Rat
1600369Hcas8Hepatocarcinoma susceptibility QTL 8liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)16122477621Rat
631830Alc7Alcohol consumption QTL 72.9consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16126727669Rat
634355Rends4Renal damage susceptibility QTL 40.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)16126727669Rat
1582235Insul8Insulin level QTL 83.30.0063blood insulin amount (VT:0001560)calculated serum insulin level (CMO:0000359)16126727669Rat
9590151Scort8Serum corticosterone level QTL 88.450.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)16130836262Rat
2302380Slep6Serum leptin concentration QTL 63.36blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)16132139025Rat
2307172Activ4Activity QTL 43.710.00023locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)16133418960Rat
1354584Despr6Despair related QTL 63.10.0067locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16139533930Rat
2303566Bw90Body weight QTL 902body mass (VT:0001259)body weight (CMO:0000012)16139533930Rat
631561Hcuc2Hepatic copper content QTL 22.8liver copper amount (VT:0003065)liver total copper weight (CMO:0001507)16139533949Rat
6903319Bw114Body weight QTL 1142.70.0037body mass (VT:0001259)body weight (CMO:0000012)16143534949Rat
7411664Foco30Food consumption QTL 30110.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)16144588133Rat
1354625Despr7Despair related QTL 73.160.016locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16144977551Rat
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1683223646053497Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
2301406Kidm39Kidney mass QTL 390.002kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)16285170915884239Rat
1300133Rf24Renal function QTL 243.64blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)16338015021361552Rat
2306902Bp339Blood pressure QTL 3390.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16338015043025077Rat
737825Alc13Alcohol consumption QTL 134.5consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760916039848Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)16422760943025077Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760943025077Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)16422760943025077Rat
737819Hcas4Hepatocarcinoma susceptibility QTL 44.43liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)16422760946975965Rat
61405Niddm6Non-insulin dependent diabetes mellitus QTL 63.660.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)16422760948972724Rat
61338Bp23Blood pressure QTL 234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760949227609Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
61372Bp40Blood pressure QTL 402.2blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)16422773017696785Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100302924 UniSTS
  100303384 UniSTS
  100911139 UniSTS
  363980 UniSTS
  364518 UniSTS
  683046 UniSTS
UniSTS 118303 UniSTS