D17Rat26 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D17Rat26

Symbol: D17Rat26
Previously known as: oxsts6363; R002-D08; R0002-D08; 
RGD ID: 34809
Expected Size: 128 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81754,050,316 - 54,050,444 (+)Marker Load Pipeline
mRatBN7.21749,354,809 - 49,354,937 (+)MAPPERmRatBN7.2
Rnor_6.01752,199,033 - 52,199,160NCBIRnor6.0
Rnor_5.01750,263,696 - 50,263,823UniSTSRnor5.0
RGSC_v3.41757,508,924 - 57,509,052RGDRGSC3.4
RGSC_v3.41757,508,925 - 57,509,052UniSTSRGSC3.4
Celera1745,413,589 - 45,413,716UniSTS
RGSC_v3.11757,511,766 - 57,511,893RGD
RH 3.4 Map17507.49RGD
RH 3.4 Map17507.49UniSTS
RH 2.0 Map17413.6RGD
SHRSP x BN Map1730.3699RGD
FHH x ACI Map1735.5199RGD
Is Marker For: Strains:   WIST/Nhg   WKY/OlaHsd   WTC/Kyo   ACI/N   AVN/Orl   BBDR/Rhw   BBDP/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN-Lx/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   COP/OlaHsd   DA/PitN   FHH/Eur   F344/Pit   GH/Omr   GK/KyoSwe   DON/Melb   M520/N   IS/Kyo   WN/N   LH/Mav   LEW/Pit   LOU/CHan   LN/Mav   MHS/Gib   MNR/N   MNRA/N   MNS/Gib   MR/Pit   NEDH/K   NP9   ODU/N   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SR/Jr   SHRSP/Riv   SS/Jr   WAG/RijKyo   WF/Pit  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. UniSTS Pipeline RGD automated pipelines
5. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
6. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer ATATGCCCATACACGTGCAA
Reverse Primer TGGTCACTTTGATAATGTAATGCTC
 

Region

Nucleotide Sequences
GenBank Nucleotide CH474030 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000247 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631497Bp98Blood pressure QTL 983.66arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)174949693265155015Rat
70210Cm15Cardiac mass QTL 156.5heart right ventricle mass (VT:0007033)heart right ventricle wet weight (CMO:0000072)173006647275066472Rat
8552966Pigfal18Plasma insulin-like growth factor 1 level QTL 188.7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)171286094257860942Rat
152023626Bp403Blood pressure QTL 4033.86arterial blood pressure trait (VT:2000000)172413612784432719Rat
2301412Kidm40Kidney mass QTL 400.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)174238816487388164Rat
9590107Sffal7Serum free fatty acids level QTL 74.810.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)173310464578104645Rat
2302377Scl61Serum cholesterol level QTL 614.36blood HDL cholesterol amount (VT:0000184)serum high density lipoprotein cholesterol level (CMO:0000361)17622199858177198Rat
1354654Spl7Serum phospholipid level QTL 75.5blood phospholipid amount (VT:0006084)blood phospholipid level (CMO:0001169)173803135483031354Rat
70157Niddm32Non-insulin dependent diabetes mellitus QTL 324.34blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)172266079955604694Rat
9589151Insul30Insulin level QTL 308.820.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)171286094257860942Rat
1598871Memor5Memory QTL 55.3exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)174096801789341781Rat
1581512Cm55Cardiac mass QTL 552.80.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)172723344583975845Rat
1354629Scl31Serum cholesterol level QTL 314.1blood cholesterol amount (VT:0000180)blood total cholesterol level (CMO:0000051)173803135483031354Rat
61394Bp8Blood pressure QTL 82.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)172328632264246472Rat
9589057Scfw6Subcutaneous fat weight QTL 68.620.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)171286094257860942Rat
2317045Aia11Adjuvant induced arthritis QTL 114.06joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)172652205171522051Rat
1600398Edcs5Endometrial carcinoma susceptibility QTL 52.2uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)173544694975762341Rat
9590154Scort9Serum corticosterone level QTL 923.570.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)171286094257860942Rat
10450503Bp386Blood pressure QTL 3860.28arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172201970567019705Rat
1559055Bp278Blood pressure QTL 2780.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172385892668858926Rat
152025238Slep14Serum leptin concentration QTL 144.62blood leptin amount (VT:0005667)172439059584432719Rat
9590088Insglur7Insulin/glucose ratio QTL 720.380.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)171286094257860942Rat
1354638Insul1Insulin level QTL 14.8blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)173803135483031354Rat
2313854Bp343Blood pressure QTL 3433.9life span trait (VT:0005372)age at time of death (CMO:0001193)173219953455604694Rat
2317053Aia25Adjuvant induced arthritis QTL 252.69joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)171060469455604694Rat
1354635Bp245Blood pressure QTL 2456arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)173803135483031354Rat
1331765Hrtrt15Heart rate QTL 154.094heart pumping trait (VT:2000009)heart rate (CMO:0000002)171553702560531414Rat
8552928Pigfal9Plasma insulin-like growth factor 1 level QTL 99blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)173310464578104645Rat
7411666Foco31Food consumption QTL 3111.40.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)171286094257860942Rat
12904736Cm121Cardiac mass QTL 1210.043heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)174238816487388164Rat
1300148Bp192Blood pressure QTL 1923.47arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)174605012691050126Rat
12903980Cm120Cardiac mass QTL 1200.002heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)172385892668858926Rat
12903981Am17Aortic mass QTL 170.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)172385892668858926Rat
4889955Bss93Bone structure and strength QTL 934.4tibia size trait (VT:0100001)tibia cortical bone volume to tibia total bone volume ratio (CMO:0001727)172723344565155015Rat
4889891Eae32Experimental allergic encephalomyelitis QTL 324.80.0002nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)172723344572233445Rat
12903982Kidm70Kidney mass QTL 700.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)172385892668858926Rat
12903978Cm118Cardiac mass QTL 1180.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)172385892668858926Rat
2324621Coatc5Coat color QTL 5coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)174265489587654895Rat
12903979Cm119Cardiac mass QTL 1190.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)172385892668858926Rat
1354619Bp242Blood pressure QTL 2426.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)173768787782687877Rat
1300129Rf25Renal function QTL 253.03blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)174106235286062352Rat
152023740Bp406Blood pressure QTL 4066.06arterial blood pressure trait (VT:2000000)172413612784432719Rat
1354663Bvd5Brain ventricular dilatation QTL 53.510.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)173219953486201342Rat
7488966Bp370Blood pressure QTL 3700.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172385892668858926Rat
152023737Bp405Blood pressure QTL 4055.06arterial blood pressure trait (VT:2000000)2413612784432719Rat
152023736Bp404Blood pressure QTL 4043.78arterial blood pressure trait (VT:2000000)172413612784432719Rat
724528Uae4Urinary albumin excretion QTL 44.90.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)173604553781045537Rat


Additional Information