D4Mgh10 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D4Mgh10

Symbol: D4Mgh10
Previously known as: R5799; oxsts9093; 
RGD ID: 34473
Expected Size: 146 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.24155,936,364 - 155,936,504 (+)MAPPERmRatBN7.2
Rnor_6.04155,523,227 - 155,523,366NCBIRnor6.0
Rnor_5.04222,546,016 - 222,546,155UniSTSRnor5.0
RGSC_v3.44159,168,092 - 159,168,232RGDRGSC3.4
RGSC_v3.44159,168,093 - 159,168,232UniSTSRGSC3.4
RGSC_v3.14159,413,028 - 159,413,168RGD
Celera4144,755,177 - 144,755,316UniSTS
Cytogenetic Map4 RGD
Is Marker For: Strains:   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   BN-Lx/Cub   LN/Mav   GH/Omr   SS/Jr   COP/OlaHsd  
QTLs:   Oia2   Oia8   Eae20  


Annotation


References - curated
# Reference Title Reference Citation
1. Quantitative trait loci disposing for both experimental arthritis and encephalomyelitis in the DA rat; impact on severity of myelin oligodendrocyte glycoprotein-induced experimental autoimmune encephalomyelitis and antibody isotype pattern. Dahlman I, etal., Eur J Immunol 1998 Jul;28(7):2188-96
2. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
3. Identification of rat susceptibility loci for adjuvant-oil-induced arthritis. Lorentzen JC, etal., Proc Natl Acad Sci U S A 1998 May 26;95(11):6383-7
4. UniSTS Pipeline RGD automated pipelines
5. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer CAGTGTACACAGTGGTGTACAGAC
Reverse Primer ATTGTGATGCTGGGGATTGA
 

Region

Nucleotide Sequences
GenBank Nucleotide JH614801.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)411320076180699135Rat
631674Iddm14Insulin dependent diabetes mellitus QTL 14blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)464528739157573521Rat
1576316Ept5Estrogen-induced pituitary tumorigenesis QTL 53.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)483428419177635233Rat
1358202Gluco11Glucose level QTL 112.40.02adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)485379421167139601Rat
634335Anxrr16Anxiety related response QTL 167.22locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)493308457167139447Rat
737821Hcar9Hepatocarcinoma resistance QTL 93.7liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)4109866907167139601Rat
1331759Hrtrt13Heart rate QTL 133.54628heart pumping trait (VT:2000009)heart rate (CMO:0000002)4110275411168266883Rat
12798519Anxrr54Anxiety related response QTL 542.540.05locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4114627026159627026Rat
724535Cm18Cardiac mass QTL 182.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)4118856416163856416Rat
1331802Srn5Serum renin concentration QTL 53.045renin activity (VT:0005581)plasma renin activity level (CMO:0000116)4119428175157578333Rat
634347Hcar8Hepatocarcinoma resistance QTL 85.8liver integrity trait (VT:0010547)liver tumorous lesion area to total liver area ratio (CMO:0001075)4123143783168143783Rat
631683Bp116Blood pressure QTL 1160.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4124303370169303370Rat
6478778Anxrr51Anxiety related response QTL 510.25384locomotor behavior trait (VT:0001392)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)4124778595169778595Rat
7411558Bw133Body weight QTL 13313.840.001body mass (VT:0001259)body weight gain (CMO:0000420)4125590636170590636Rat
61451Ciaa4CIA Autoantibody QTL 43.1blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)4126395976167139601Rat
737978Pia23Pristane induced arthritis QTL 235.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4131730738167139601Rat
631511Pia7Pristane induced arthritis QTL 74.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4131730738167139601Rat
1549827Scl46Serum cholesterol level QTL 463.5blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)4132396220177396220Rat
724558Plsm2Polydactyly-luxate syndrome (PLS) morphotypes QTL 20.0003hindlimb integrity trait (VT:0010563)hind foot phalanges count (CMO:0001949)4132422778177422778Rat
61422Cia13Collagen induced arthritis QTL 134.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4132642577167139601Rat
2303623Vencon2Ventilatory control QTL 23.8respiration trait (VT:0001943)minute ventilation (CMO:0000132)4135204660180204660Rat
1578674Bmd12Bone mineral density QTL 123.8femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)4135699135180699135Rat
2293659Bmd35Bone mineral density QTL 354.50.0001femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)4137755016181392681Rat
61362Oia2Oil induced arthritis QTL 20.001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4138503169173369699Rat
1298524Oia8Oil induced arthritis QTL 8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4138503169173369699Rat
1331738Bp209Blood pressure QTL 2092.979arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)4138503169179293946Rat
6478718Anxrr34Anxiety related response QTL 340.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat
6478748Anxrr42Anxiety related response QTL 420.28008locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat
6478754Anxrr43Anxiety related response QTL 430.14035locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4144639524182687754Rat
6478693Anxrr32Anxiety related response QTL 320.00092locomotor behavior trait (VT:0001392)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)4144639524182687754Rat
6478700Anxrr33Anxiety related response QTL 330.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat
10401796Kidm48Kidney mass QTL 48kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)4145568712182687754Rat
634342Cia24Collagen induced arthritis QTL 244.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4146565735175236377Rat
12798525Anxrr57Anxiety related response QTL 573.210.05locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4147278504167139601Rat
1582237Kidm34Kidney mass QTL 3440.0001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)4148090542168069246Rat
61446Coreg2Compensatory renal growth QTL 23.5kidney mass (VT:0002707)compensatory renal growth score (CMO:0001894)4148423102157580971Rat
1581574Eae20Experimental allergic encephalomyelitis QTL 207.8nervous system integrity trait (VT:0010566)percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047)4153031106158841762Rat
10053718Scort25Serum corticosterone level QTL 252.150.0097blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)4155561574182687754Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100303212 UniSTS
  326378 UniSTS
  444896 UniSTS
UniSTS 120431 UniSTS