D15Mgh9 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: D15Mgh9

Symbol:

D15Mgh9

Previously known as:

oxsts8903; R1103-A08;

RGD ID:

34409

Expected Size:

158 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
GRCr8	15	88,677,086 - 88,677,244 (+)	Marker Load Pipeline
mRatBN7.2	15	82,262,520 - 82,262,678 (+)	MAPPER	mRatBN7.2
Rnor_6.0	15	89,640,684 - 89,640,841	NCBI	Rnor6.0
Rnor_5.0	15	93,131,834 - 93,131,991	UniSTS	Rnor5.0
RGSC_v3.4	15	89,569,706 - 89,569,864	RGD	RGSC3.4
RGSC_v3.4	15	89,569,707 - 89,569,864	UniSTS	RGSC3.4
Celera	15	81,377,978 - 81,378,135	UniSTS
RGSC_v3.1	15	89,585,486 - 89,585,644	RGD
SHRSP x BN Map	15	52.8498	UniSTS
SHRSP x BN Map	15	52.8498	RGD
Cytogenetic Map	15	q22	UniSTS

Is Marker For:

Strains: ACI/N AVN/Orl BBDR/Rhw BBDP/Rhw BC/CpbU BDIX/Han BDVII/Cub BN-Lx/Cub BN/SsNHsd BP/Cub BUF/Pit COP/OlaHsd DA/PitN FHH/Eur F344/Pit GH/Omr GK/KyoSwe DON/Melb M520/N IS/Kyo WN/N LH/Mav LE/Mol LEW/Pit LOU/CHan LN/Mav MHS/Gib MNR/N MNRA/N MNS/Gib MR/Pit NEDH/K NP9 ODU/N OKA/Wsl OM/Ztm P5C PVG/Pit SD/Rij SHR/OlaHsd SR/Jr SHRSP/Riv SS/Jr WAG/RijKyo WF/Pit WIST/Nhg WKY/OlaHsd WTC/Kyo
QTLs: Bp190 Kidm7 Rf23 Bp223 Stl21 Gluco30 Epfw3 Gluco28 Bw79
Genes: LOC692040 LOC100910379

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	Rat Genetic Map Data	Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3.	Electronic Transfer of SSLP Data	Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4.	UniSTS Pipeline	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	TCTTCAGTCTCTCGGGTTAAGC
Reverse Primer	GACCGTGTATTTTCTCCTCACA

Strain Variation

Strain, Expected Size(s)

ACI/N	142
AVN/Orl	142
BBDP/Rhw	142
BBDR/Rhw	142
BC/CpbU	144
BDIX/Han	142
BDVII/Cub	142
BN-Lx/Cub	158
BN/SsNHsd	158
BP/Cub	142
BUF/Pit	142
COP/OlaHsd	142
DA/PitN	142

DON/Melb	138
F344/Pit	142
FHH/Eur	142
GH/Omr	142
GK/KyoSwe	140
IS/Kyo	132
LE/Mol	142
LEW/Pit	142
LH/Mav	142
LN/Mav	144
LOU/CHan	142
M520/N	142
MHS/Gib	142

MNR/N	144
MNRA/N	144
MNS/Gib	142
MR/Pit	144
NEDH/K	132
NP9	140
ODU/N	142
OKA/Wsl	142
OM/Ztm	142
P5C	142
PVG/Pit	142
SD/Rij	140
SHR/OlaHsd	142

SHRSP/Riv	144
SR/Jr	144
SS/Jr	144
WAG/RijKyo	142
WF/Pit	158
WIST/Nhg	142
WKY/OlaHsd	158
WN/N	142
WTC/Kyo	142

Region

Nucleotide Sequences


GenBank Nucleotide	CH473951	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CM000245	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (GRCr8)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1549844	Bss7	Bone structure and strength QTL 7	6.4		femur strength trait (VT:0010010)	femur midshaft polar moment of inertia (CMO:0001669)	15	75788062	101769107	Rat
2300326	Plaw1	Placental weight QTL 1	15	0.005	placenta mass (VT:0004257)	placenta wet weight (CMO:0002088)	15	68327165	100062518	Rat
1300118	Bp190	Blood pressure QTL 190	2.94		arterial blood pressure trait (VT:2000000)	blood pressure measurement (CMO:0000003)	15	82262520	98288169	Rat
70155	Gcs1	Gastric cancer susceptibility QTL1	3.8		stomach morphology trait (VT:0000470)	stomach tumor susceptibility score (CMO:0002043)	15	76306099	101769107	Rat
1582227	Gluco30	Glucose level QTL 30	3.6	0.0003	blood glucose amount (VT:0000188)	absolute change in blood glucose level area under curve (CMO:0002034)	15	28030665	82262678	Rat
1300120	Kidm7	Kidney mass QTL 7	3.55		kidney mass (VT:0002707)	left kidney wet weight to body weight ratio (CMO:0001954)	15	82262520	98288169	Rat
1582228	Epfw3	Epididymal fat weight QTL 3	4.1	0.0002	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	15	28030665	82262678	Rat
1578646	Bmd18	Bone mineral density QTL 18	5.2		femur mineral mass (VT:0010011)	trabecular volumetric bone mineral density (CMO:0001729)	15	22806240	98288169	Rat
1578647	Bmd17	Bone mineral density QTL 17	4		femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	15	22806240	98288169	Rat
631516	Gluco31	Glucose level QTL 31	7		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	15	55596089	95018120	Rat
1331724	Bp223	Blood pressure QTL 223	3.53715		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	15	73690518	95018228	Rat
2317055	Aia10	Adjuvant induced arthritis QTL 10	3.41		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	15	75788062	101769107	Rat
1582214	Stl21	Serum triglyceride level QTL 21	3.1	0.022	blood triglyceride amount (VT:0002644)	serum triglyceride level (CMO:0000360)	15	28030665	82262678	Rat
731177	Uae26	Urinary albumin excretion QTL 26	2.4	0.025	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	15	67588667	101769107	Rat
1576315	Schws6	Schwannoma susceptibility QTL 6		0.0069	nervous system integrity trait (VT:0010566)	post-insult time of death (CMO:0002005)	15	53806152	98806152	Rat
1300144	Rf23	Renal function QTL 23	3.61		renal blood flow trait (VT:2000006)	absolute change in renal vascular resistance (CMO:0001900)	15	40631268	98288169	Rat
61477	Aia4	Adjuvant induced arthritis QTL 4	3		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	15	55596089	91365858	Rat
70182	BpQTLcluster12	Blood pressure QTL cluster 12	3.53		arterial blood pressure trait (VT:2000000)	absolute change in mean arterial blood pressure (CMO:0000533)	15	73690657	95018120	Rat
152025253	Hrtrt24	Heart rate QTL 24	3.82		heart pumping trait (VT:2000009)		15	27885774	86257085	Rat
1581555	Eae19	Experimental allergic encephalomyelitis QTL 19	4.7		nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis severity score (CMO:0001419)	15	76306099	90088744	Rat
631655	Bp126	Blood pressure QTL 126	4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	15	58156477	101769107	Rat
1641889	Colcr6	Colorectal carcinoma resistance QTL 6	2.9	0.0126	intestine integrity trait (VT:0010554)	benign colorectal tumor surface area measurement (CMO:0001799)	15	73690518	99794247	Rat
1582242	Gluco28	Glucose level QTL 28	3.3	0.0008	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	15	28030665	82262678	Rat
1582244	Bw79	Body weight QTL 79	4	0.0002	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	15	28030665	82262678	Rat
1578660	Bss19	Bone structure and strength QTL 19	4.3		femur morphology trait (VT:0000559)	bone trabecular cross-sectional area (CMO:0002311)	15	22806240	98288169	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	100302857	UniSTS
	100302863	UniSTS
	100303103	UniSTS
	100303104	UniSTS
	100303215	UniSTS
	100910379	UniSTS
	444917	UniSTS
	444919	UniSTS
	444943	UniSTS
	544344	UniSTS
	692040	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D15Mgh9