D18Mgh4 Marker Search Result - Rat Genome Database

Send us a Message



 Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap)  (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: D18Mgh4

Symbol: D18Mgh4
Previously known as: oxsts5775; oxsts5771; oxsts5714; D20Mgh2; D18Mgh4H; D18Mgh4L; D20Mgh2H; 
RGD ID: 34290
Expected Size: 126 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.26118,921,813 - 118,921,891 (-)MAPPERmRatBN7.2
mRatBN7.21876,477,814 - 76,477,940 (+)MAPPERmRatBN7.2
Rnor_6.01879,948,616 - 79,948,741NCBIRnor6.0
Rnor_5.01879,012,527 - 79,012,652UniSTSRnor5.0
Rnor_5.01879,012,526 - 79,012,652NCBIRnor5.0
RGSC_v3.41879,585,008 - 79,585,133UniSTSRGSC3.4
RGSC_v3.11879,658,281 - 79,658,406RGD
Celera1875,108,134 - 75,108,259UniSTS
RH 3.4 Map18813.5RGD
RH 3.4 Map18813.5UniSTS
RH 2.0 Map1844.4RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   BN.GH-(D18Rat41-D18Mgh4)/Mcwi  
QTLs:   Eae15   BpQTLcluster15   Hrtrt16   Bw58   Bp324   Bw103   Bw107  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer CCTAGGCAGTAGTTACCATGTGC
Reverse Primer TGTTTCTGTTGCCCTCGAG
 

Region

Nucleotide Sequences
GenBank Nucleotide CH474021 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000248 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
731173Uae22Urinary albumin excretion QTL 2210.1urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
2290393Uae37Urinary albumin excretion QTL 370.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
724536Uae7Urinary albumin excretion QTL 73.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)672202632130729475Rat
1331799Bp211Blood pressure QTL 2113.66407arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)672202632130919985Rat
1581550Pur8Proteinuria QTL 8urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)672227641130729205Rat
1581563Uae33Urinary albumin excretion QTL 33urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)672227641130729205Rat
738034Anxrr5Anxiety related response QTL 55.9exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)684130881129130881Rat
10054138Gmadr3Adrenal mass QTL 33.680.00045adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)685140138130140138Rat
10054123Srcrt6Stress Responsive Cort QTL 62.50.0043blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)685140138130140138Rat
724513Uae14Urinary albumin excretion QTL 146.5urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)685311061133478515Rat
1300076Glom8Glomerulus QTL 870.000000009kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)686894788131894788Rat
2303624Vencon5Ventilatory control QTL 54.45respiration trait (VT:0001943)minute ventilation (CMO:0000132)688047916133047916Rat
1331725Bp212Blood pressure QTL 2123.52475arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)693701310128713626Rat
61414Pia3Pristane induced arthritis QTL 34.5joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)694968928137848904Rat
12801411Schws8Schwannoma susceptibility QTL 8nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)694968928139968928Rat
8552796Vie3Viral induced encephalitis QTL 32.6brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)696833997140994061Rat
1358355Srcrt4Stress Responsive Cort QTL 46.39blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)6100364669140994061Rat
2313399Anxrr28Anxiety related response QTL 28aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)6100671796132340886Rat
1331797Bp213Blood pressure QTL 2133.291arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)6104085867128713626Rat
71111Iddm8Insulin dependent diabetes mellitus QTL 81.90.002blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)6105156861140994061Rat
4145118Mcs26Mammary carcinoma susceptibility QTL 260.0001mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)6106752656132339866Rat
737976Pia24Pristane induced arthritis QTL 24joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)6112636280140994061Rat
1298087Iddm18Insulin dependent diabetes mellitus QTL 180.0001urine glucose amount (VT:0001758)percentage of study population developing diabetes mellitus during a period of time (CMO:0001114)6116506292130245370Rat
1578661Bss20Bone structure and strength QTL 203.7femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)181179151883218561Rat
1578667Bss21Bone structure and strength QTL 213.5femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)181179151883218561Rat
1600373Mamtr6Mammary tumor resistance QTL 6mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)181927890183218561Rat
1331741Bp232Blood pressure QTL 2323.59112arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)182137289383213037Rat
1331733Bp233Blood pressure QTL 2333.97196arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182479697779788953Rat
2303120Mamtr8Mammary tumor resistance QTL 80.001mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)183135940883218561Rat
631274Sprol1Serum protein level QTL 15.3blood total protein amount (VT:0005567)serum total protein level (CMO:0000661)183139332077209694Rat
631518Bw11Body weight QTL 112.8body mass (VT:0001259)body weight (CMO:0000012)183587072380870723Rat
61367Iddm4Insulin dependent diabetes mellitus QTL 42.330.0074blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)183819245583192455Rat
1598826Anxrr20Anxiety related response QTL 203.04body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)184143297183828827Rat
6893683Bw110Body weight QTL 1102.70.002body mass (VT:0001259)body weight (CMO:0000012)184334502283828827Rat
8694366Abfw8Abdominal fat weight QTL 86.380.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)184664067583828827Rat
8694432Bw165Body weight QTL 1653.810.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)184664067583828827Rat
9589041Epfw12Epididymal fat weight QTL 1217.080.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)184664067583828827Rat
2303571Bw92Body weight QTL 923body mass (VT:0001259)body weight (CMO:0000012)184852004483828827Rat
2303584Gluco55Glucose level QTL 552blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)184852004483828827Rat
738008Hcar14Hepatocarcinoma resistance QTL 144.3liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion number (CMO:0001462)185146473383218561Rat
1298072Cia26Collagen induced arthritis QTL 263.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)185470976983828827Rat
724542Kidm2Kidney mass QTL 22.6kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)185917211583828827Rat
2301969Bp324Blood pressure QTL 3244.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)185971241776477814Rat
70185BpQTLcluster15Blood pressure QTL cluster 154.61arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)185971241776477814Rat
70185BpQTLcluster15Blood pressure QTL cluster 154.61arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)185971241776477814Rat
70185BpQTLcluster15Blood pressure QTL cluster 154.61arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)185971241776477814Rat
70185BpQTLcluster15Blood pressure QTL cluster 154.61arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)185971241776477814Rat
6903353Bp353Blood pressure QTL 3532.8arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)185979647883828827Rat
6903356Bp354Blood pressure QTL 3544.6arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)185979647883828827Rat
61384Bp48Blood pressure QTL 4819.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)186062231177209844Rat
631675Iddm15Insulin dependent diabetes mellitus QTL 15urine glucose amount (VT:0001758)percentage of study population developing diabetes mellitus during a period of time (CMO:0001114)186062231177209844Rat
634333Pia19Pristane induced arthritis QTL 193.4joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)187399714079532029Rat
70172Eae15Experimental allergic encephalomyelitis QTL 150.001nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)187647781477209844Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100302799 UniSTS
  100303371 UniSTS
  101027077 UniSTS
  101027081 UniSTS
  326498 UniSTS
  326511 UniSTS
  544367 UniSTS
UniSTS 118461 UniSTS