D9Mgh5 Marker Search Result - Rat Genome Database

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

General

Marker: D9Mgh5

Symbol:

D9Mgh5

Previously known as:

oxsts5348; R5083;

RGD ID:

34264

Expected Size:

150 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	9	5,857,783 - 5,857,951 (-)	MAPPER	mRatBN7.2
Rnor_6.0	9	3,309,754 - 3,309,921	NCBI	Rnor6.0
Rnor_5.0	9	37,250,734 - 37,250,901	UniSTS	Rnor5.0
RGSC_v3.4	9	2,176,482 - 2,176,650	RGD	RGSC3.4
RGSC_v3.4	9	2,176,483 - 2,176,650	UniSTS	RGSC3.4
RGSC_v3.1	9	2,176,482 - 2,176,650	RGD
Celera	9	2,719,700 - 2,719,867	UniSTS
Cytogenetic Map	9	q11	UniSTS

Is Marker For:

Strains: AVN/Orl BBDP/Rhw BBDR/Rhw BC/CpbU BDIX/Han BDVII/Cub BN/SsNHsd BP/Cub BUF/Pit DA/PitN DON/Melb F344/Pit FHH/Eur IS/Kyo LE/Mol LEW/Pit LH/Mav MHS/Gib MNRA/N WN/N WKY/OlaHsd WTC/Kyo LOU/CHan MNR/N MR/Pit ODU/N WF/Pit WIST/Nhg SR/Jr MNS/Gib NP9 OKA/Wsl OM/Ztm P5C PVG/Pit SD/Rij SHR/OlaHsd SHRSP/Riv WAG/RijKyo GK/KyoSwe M520/N ACI/N BN-Lx/Cub LN/Mav GH/Omr NEDH/K SS/Jr COP/OlaHsd
QTLs: Cia15 Eae4 Iresp3
Genes: Kcnh8

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	Genetic dissection of a rat model for rheumatoid arthritis: significant gender influences on autosomal modifier loci	Furuya T, etal., Hum Mol Genet 2000 Sep 22;9(15):2241-50
3.	UniSTS Pipeline	RGD automated pipelines
4.	Electronic Submission of SSLP Data Sets	Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence


Forward Primer	ACAAGGCAAAACTAAATGAACTCA
Reverse Primer	TTGTTGATTTGAAAGGTCATTCC

Strain Variation

Strain, Expected Size(s)

ACI/N	160
AVN/Orl	158
BBDP/Rhw	160
BBDR/Rhw	160
BC/CpbU	158
BDIX/Han	160
BDVII/Cub	160
BN-Lx/Cub	170
BN/SsNHsd	170
BP/Cub	160
BUF/Pit	162
COP/OlaHsd	160
DA/PitN	162

DON/Melb	162
F344/Pit	162
FHH/Eur	170
GH/Omr	162
GK/KyoSwe	151
IS/Kyo	158
LE/Mol	162
LEW/Pit	162
LH/Mav	168
LN/Mav	166
LOU/CHan	162
M520/N	154
MHS/Gib	170

MNR/N	160
MNRA/N	160
MNS/Gib	170
MR/Pit	162
NEDH/K	168
NP9	170
ODU/N	151
OKA/Wsl	151
OM/Ztm	170
P5C	162
PVG/Pit	162
SD/Rij	162
SHR/OlaHsd	151

SHRSP/Riv	151
SR/Jr	162
SS/Jr	170
WAG/RijKyo	162
WF/Pit	170
WIST/Nhg	170
WKY/OlaHsd	151
WN/N	170
WTC/Kyo	151

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
2549	Kcnh8	potassium voltage-gated channel subfamily H member 8	9	5506044	5945828	Rat

Nucleotide Sequences


GenBank Nucleotide	CH474081	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CM000239	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
10054141	Gmadr4	Adrenal mass QTL 4	2.45	0.0074	adrenal gland mass (VT:0010420)	both adrenal glands wet weight (CMO:0000164)	9	1	14209783	Rat
70226	Eae4	Experimental allergic encephalomyelitis QTL 4			nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)	9	1	25661317	Rat
9589055	Scfw5	Subcutaneous fat weight QTL 5	5.55	0.001	subcutaneous adipose mass (VT:1000472)	abdominal subcutaneous fat pad weight (CMO:0002069)	9	1	37999212	Rat
7411592	Foco8	Food consumption QTL 8	7.4	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	9	1	37999212	Rat
9589158	Gluco65	Glucose level QTL 65	6.82	0.001	blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	9	1	37999212	Rat
1300124	Cm4	Cardiac mass QTL 4	3.55		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	9	1	40594091	Rat
1298088	Edpm11	Estrogen-dependent pituitary mass QTL 11	2.5		pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	9	1	43718459	Rat
1641911	Alcrsp13	Alcohol response QTL 13			response to alcohol trait (VT:0010489)	brain neurotensin receptor 1 density (CMO:0002068)	9	1	43718459	Rat
10054125	Srcrt7	Stress Responsive Cort QTL 7	3.33	0.0011	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	9	1	87073594	Rat
1331757	Cdexp1	CD45RC expression in CD8 T cells QTL 1	4.3		CD8-positive T cell quantity (VT:0008077)	blood CD45RC(high) CD8 T cell count to CD45RC(low) CD8 T cell count ratio (CMO:0001990)	9	1024537	67509080	Rat
1354650	Despr5	Despair related QTL 5	4.01	0.0017	locomotor behavior trait (VT:0001392)	amount of time spent in voluntary immobility (CMO:0001043)	9	1254084	46254084	Rat
2303559	Gluco54	Glucose level QTL 54	2		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	9	1254084	46254084	Rat
631533	Iresp3	Immunoglobin response QTL3	16.2		blood immunoglobulin E amount (VT:0002492)	serum total immunoglobulin E level (CMO:0001542)	9	2745799	5857951	Rat
1578675	Bss17	Bone structure and strength QTL 17	3.8		femur morphology trait (VT:0000559)	femoral neck cortical cross-sectional area (CMO:0001702)	9	3368652	13533896	Rat
61425	Cia15	Collagen induced arthritis QTL 15	4.6		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	9	5109826	42921101	Rat
631211	Bw4	Body weight QTL4	5.31		retroperitoneal fat pad mass (VT:0010430)	retroperitoneal fat pad weight to body weight ratio (CMO:0000635)	9	5109826	50109826	Rat

Additional Information

RGD Curation Notes

Note Type	Note	Reference

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	246325	UniSTS
	326433	UniSTS
	326551	UniSTS
	369102	UniSTS
UniSTS	119404	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D9Mgh5