D4Mgh18 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D4Mgh18

Symbol: D4Mgh18
Previously known as: R5064; oxsts5034; 
RGD ID: 34256
Expected Size: 124 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.24126,395,976 - 126,396,065 (+)MAPPERmRatBN7.2
mRatBN7.21862,057,116 - 62,057,171 (+)MAPPERmRatBN7.2
Rnor_6.04125,884,464 - 125,884,552NCBIRnor6.0
Rnor_5.04190,397,443 - 190,397,531UniSTSRnor5.0
RGSC_v3.44128,179,957 - 128,180,046RGDRGSC3.4
RGSC_v3.44128,179,958 - 128,180,046UniSTSRGSC3.4
RGSC_v3.14128,424,798 - 128,424,887RGD
Celera4115,307,251 - 115,307,339UniSTS
RH 3.4 Map4757.7UniSTS
RH 3.4 Map4757.7RGD
RH 2.0 Map4847.3RGD
Cytogenetic Map4q34UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Ciaa4  
Genes:   Magi1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Genetic dissection of a rat model for rheumatoid arthritis: significant gender influences on autosomal modifier loci Furuya T, etal., Hum Mol Genet 2000 Sep 22;9(15):2241-50
3. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
4. UniSTS Pipeline RGD automated pipelines
5. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
6. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
7. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer TTATTGCTGCTACACACACACG
Reverse Primer AACATTCTCACCAGCTCATAAGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1586025Magi1membrane associated guanylate kinase, WW and PDZ domain containing 14126205663126811354Rat

Nucleotide Sequences
GenBank Nucleotide CH473957 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000234 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2293708Bss46Bone structure and strength QTL 468.80.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)181179151863636873Rat
1578661Bss20Bone structure and strength QTL 203.7femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)181179151883218561Rat
1578667Bss21Bone structure and strength QTL 213.5femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)181179151883218561Rat
1358193Emca2Estrogen-induced mammary cancer QTL 21.6mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)181800759963571040Rat
1600373Mamtr6Mammary tumor resistance QTL 6mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)181927890183218561Rat
1331741Bp232Blood pressure QTL 2323.59112arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)182137289383213037Rat
1331733Bp233Blood pressure QTL 2333.97196arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182479697779788953Rat
2325839Bp348Blood pressure QTL 3480.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182557098570570985Rat
2293704Bss35Bone structure and strength QTL 354.590.0002femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)182896485373964853Rat
2300157Bmd66Bone mineral density QTL 6613.10.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)182896485373964853Rat
2300177Bmd65Bone mineral density QTL 6519.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)182896485373964853Rat
9589816Gluco68Glucose level QTL 687.250.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)182979296574792965Rat
8694378Bw157Body weight QTL 1573.590.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)182979296574792965Rat
9590318Scort22Serum corticosterone level QTL 227.640.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)182979296574792965Rat
1331754Bp230Blood pressure QTL 2304.61609arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182979296574792965Rat
738005Anxrr11Anxiety related response QTL 113.4exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)183003981375039813Rat
61429Cia17Collagen induced arthritis QTL 174.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)183135940870263868Rat
2303120Mamtr8Mammary tumor resistance QTL 80.001mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)183135940883218561Rat
631274Sprol1Serum protein level QTL 15.3blood total protein amount (VT:0005567)serum total protein level (CMO:0000661)183139332077209694Rat
631518Bw11Body weight QTL 112.8body mass (VT:0001259)body weight (CMO:0000012)183587072380870723Rat
61367Iddm4Insulin dependent diabetes mellitus QTL 42.330.0074blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)183819245583192455Rat
1598826Anxrr20Anxiety related response QTL 203.04body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)184143297183828827Rat
6893683Bw110Body weight QTL 1102.70.002body mass (VT:0001259)body weight (CMO:0000012)184334502283828827Rat
8694366Abfw8Abdominal fat weight QTL 86.380.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)184664067583828827Rat
8694432Bw165Body weight QTL 1653.810.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)184664067583828827Rat
9589041Epfw12Epididymal fat weight QTL 1217.080.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)184664067583828827Rat
2303571Bw92Body weight QTL 923body mass (VT:0001259)body weight (CMO:0000012)184852004483828827Rat
2303584Gluco55Glucose level QTL 552blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)184852004483828827Rat
7411719Strs5Sensitivity to stroke QTL 59.4cerebrum integrity trait (VT:0010549)percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932)184999995865845095Rat
2293658Bmd23Bone mineral density QTL 237.30.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)185146473363636873Rat
738008Hcar14Hepatocarcinoma resistance QTL 144.3liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion number (CMO:0001462)185146473383218561Rat
1331752Bw27Body weight QTL 272.963body mass (VT:0001259)body weight (CMO:0000012)185229287565845095Rat
1359020Ppulsi2Prepulse inhibition QTL 22.71prepulse inhibition trait (VT:0003088)acoustic startle response measurement (CMO:0001519)185229287573997283Rat
1600375Mcs22Mammary carcinoma susceptibility QTL 223.3mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)185253976363933058Rat
631509Sald2Serum aldosterone level QTL 22.9blood aldosterone amount (VT:0005346)serum aldosterone level (CMO:0000487)185253976369140759Rat
12880368Bw187Body weight QTL 1870.045body mass (VT:0001259)body weight (CMO:0000012)185253976376104388Rat
12904067Cm122Cardiac mass QTL 1220.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)185253976376104388Rat
12904069Cm123Cardiac mass QTL 1230.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)185253976376104388Rat
12904070Cm124Cardiac mass QTL 1240.01heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)185253976376104388Rat
12904071Am18Aortic mass QTL 180.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)185253976376104388Rat
12904073Kidm71Kidney mass QTL 710.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)185253976376104388Rat
2301417Bp319Blood pressure QTL 3190.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)185253976376104388Rat
1300125Rf26Renal function QTL 263.2urine potassium amount (VT:0010539)urine potassium excretion rate (CMO:0000761)185253986365844950Rat
1298072Cia26Collagen induced arthritis QTL 263.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)185470976983828827Rat
631834Sach3Saccharin preference QTL 33.90.01consumption behavior trait (VT:0002069)calculated saccharin drink intake volume (CMO:0001600)185880568763636873Rat
724542Kidm2Kidney mass QTL 22.6kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)185917211583828827Rat
2312600Bp341Blood pressure QTL 3410.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)185933040970263868Rat
2301969Bp324Blood pressure QTL 3244.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)185971241776477814Rat
70185BpQTLcluster15Blood pressure QTL cluster 154.61arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)185971241776477814Rat
70185BpQTLcluster15Blood pressure QTL cluster 154.61arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)185971241776477814Rat
70185BpQTLcluster15Blood pressure QTL cluster 154.61arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)185971241776477814Rat
70185BpQTLcluster15Blood pressure QTL cluster 154.61arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)185971241776477814Rat
1331770Bp234Blood pressure QTL 2343.807arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)185979647871893566Rat
6903353Bp353Blood pressure QTL 3532.8arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)185979647883828827Rat
6903356Bp354Blood pressure QTL 3544.6arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)185979647883828827Rat
61384Bp48Blood pressure QTL 4819.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)186062231177209844Rat
631675Iddm15Insulin dependent diabetes mellitus QTL 15urine glucose amount (VT:0001758)percentage of study population developing diabetes mellitus during a period of time (CMO:0001114)186062231177209844Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)45214602146446691Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)411320076180699135Rat
1358352Srcrt3Stress Responsive Cort QTL 32.29blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)438465774146803430Rat
1576305Emca6Estrogen-induced mammary cancer QTL 65.8mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)444463720155883716Rat
1354612Foco1Food consumption QTL 18.87eating behavior trait (VT:0001431)food intake rate (CMO:0000427)444463908148090542Rat
1354660Salc1Saline consumption QTL 111.26drinking behavior trait (VT:0001422)saline drink intake rate (CMO:0001627)444463908148090542Rat
2312567Glom19Glomerulus QTL 191.90.006kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)445456990146803430Rat
1298082Stresp4Stress response QTL 4blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)450119848146803430Rat
70200Alc18Alcohol consumption QTL 189.2drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)456647873149491524Rat
738009Sach4Saccharine consumption QTL 44.90.000016consumption behavior trait (VT:0002069)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)459948935154902892Rat
738016Alc16Alcohol consumption QTL 163.60.00015consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)459948935154902892Rat
738031Alc14Alcohol consumption QTL 147.60.00003consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)459948935154902892Rat
61418Pia5Pristane induced arthritis QTL 54.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)462277855128289560Rat
631674Iddm14Insulin dependent diabetes mellitus QTL 14blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)464528739157573521Rat
61330Eau1Experimental allergic uveoretinitis QTL 10.0003uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)470362013132642728Rat
631646Stl4Serum triglyceride level QTL 46.50.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)473169846132642728Rat
70177Xhs1X-ray hypersensitivity QTL 125.1intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)482798864152731274Rat
1576316Ept5Estrogen-induced pituitary tumorigenesis QTL 53.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)483428419177635233Rat
634334Xhs3X-ray hypersensitivity QTL 310intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)484728680129854654Rat
1582232Gluco25Glucose level QTL 253.60.0023blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)485253748148090731Rat
12798523Anxrr56Anxiety related response QTL 562.830.05locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)485253748150276390Rat
1358202Gluco11Glucose level QTL 112.40.02adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)485379421167139601Rat
61476Aia3Adjuvant induced arthritis QTL 33.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)486730991131730991Rat
1578662Bss15Bone structure and strength QTL 1519.6femur width (VT:1000666)femoral neck width (CMO:0001695)487327165132327165Rat
1578670Bss14Bone structure and strength QTL 1416.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)487327165132327165Rat
1578655Bmd11Bone mineral density QTL 1111femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)490850165135850165Rat
634335Anxrr16Anxiety related response QTL 167.22locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)493308457167139447Rat
631689Scl4Serum cholesterol level QTL 41.90.008blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)495174120140174120Rat
61434Cia3Collagen induced arthritis QTL 34.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4103194656148194656Rat
2302049Pia32Pristane induced arthritis QTL 325.10.001blood autoantibody amount (VT:0003725)serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112)4105789505150789505Rat
731165Uae21Urinary albumin excretion QTL 212.40.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)4106649412151649412Rat
61406Scwia1Streptococcal cell wall induced arthritis QTL 12.3joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)4106805662151805662Rat
7207480Bss105Bone structure and strength QTL 1058.1femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)4109827074154827074Rat
1549832Bss3Bone structure and strength QTL 311femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)4109827074154827074Rat
737821Hcar9Hepatocarcinoma resistance QTL 93.7liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)4109866907167139601Rat
1331759Hrtrt13Heart rate QTL 133.54628heart pumping trait (VT:2000009)heart rate (CMO:0000002)4110275411168266883Rat
6478760Anxrr45Anxiety related response QTL 450.06717locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4110870972155870972Rat
6478763Anxrr46Anxiety related response QTL 460.07428locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4110870972155870972Rat
12798519Anxrr54Anxiety related response QTL 542.540.05locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4114627026159627026Rat
1300116Hrtrt5Heart rate QTL 53.76heart pumping trait (VT:2000009)heart rate (CMO:0000002)4116179486151161268Rat
724535Cm18Cardiac mass QTL 182.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)4118856416163856416Rat
1331802Srn5Serum renin concentration QTL 53.045renin activity (VT:0005581)plasma renin activity level (CMO:0000116)4119428175157578333Rat
12798527Anxrr58Anxiety related response QTL 584.110.05locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4119463257147278687Rat
70201Gcr1Gastric cancer resistance QTL 12.7stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)4120260281147278687Rat
2293840Kiddil9Kidney dilation QTL 92.9kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)4120926564148090731Rat
634347Hcar8Hepatocarcinoma resistance QTL 85.8liver integrity trait (VT:0010547)liver tumorous lesion area to total liver area ratio (CMO:0001075)4123143783168143783Rat
631683Bp116Blood pressure QTL 1160.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4124303370169303370Rat
6478778Anxrr51Anxiety related response QTL 510.25384locomotor behavior trait (VT:0001392)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)4124778595169778595Rat
7411558Bw133Body weight QTL 13313.840.001body mass (VT:0001259)body weight gain (CMO:0000420)4125590636170590636Rat
61451Ciaa4CIA Autoantibody QTL 43.1blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)4126395976167139601Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 326453 UniSTS
  500261 UniSTS
UniSTS 119589 UniSTS