D3Mgh5 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D3Mgh5

Symbol: D3Mgh5
Previously known as: oxsts9081; R3948; 
RGD ID: 34228
Expected Size: 131 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2398,535,255 - 98,535,386 (+)MAPPERmRatBN7.2
Rnor_6.03103,141,814 - 103,141,944NCBIRnor6.0
Rnor_5.03109,733,850 - 109,733,980UniSTSRnor5.0
RGSC_v3.4397,523,869 - 97,524,000RGDRGSC3.4
RGSC_v3.4397,523,870 - 97,524,000UniSTSRGSC3.4
Celera397,537,491 - 97,537,621UniSTS
RGSC_v3.1397,420,298 - 97,420,428RGD
RH 3.4 Map3781.29RGD
RH 3.4 Map3781.29UniSTS
Cytogenetic Map3q34UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   DON/Melb   FHH/Eur   IS/Kyo   LEW/Pit   MHS/Gib   MNRA/N   WN/N   WTC/Kyo   LOU/CHan   MR/Pit   ODU/N   WIST/Nhg   NP9   OM/Ztm   PVG/Pit   SHR/OlaHsd   GK/KyoSwe   COP/OlaHsd   DA.WOKW-(D3Mgh5-D3Rat1)/K   SS/Jr   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   F344/Pit   LE/Mol   LH/Mav   WKY/OlaHsd   MNR/N   WF/Pit   SR/Jr   MNS/Gib   OKA/Wsl   P5C   SD/Rij   SHRSP/Riv   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K  
QTLs:   Cia11   Gluco39   Slep7   Bw94   Scl63  
Genes:   Or4f14f  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Identification of four new quantitative trait loci regulating arthritis severity and one new quantitative trait locus regulating autoantibody production in rats with collagen-induced arthritis. Griffiths MM, etal., Arthritis Rheum 2000 Jun;43(6):1278-89
3. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
4. UniSTS Pipeline RGD automated pipelines
5. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer AGCCATGACATTGTCTTCTGG
Reverse Primer GAACTTTTTGAATGGGATAAAGAA
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473949 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000233 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100302991 UniSTS
  100303630 UniSTS
  100303638 UniSTS
  100303641 UniSTS
  326427 UniSTS
  404795 UniSTS