D15Mgh8 Marker Search Result - Rat Genome Database

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

General

Marker: D15Mgh8

Symbol:

D15Mgh8

Previously known as:

R0202-B08; R3913; oxsts8902;

RGD ID:

34222

Expected Size:

139 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	15	73,690,518 - 73,690,657 (+)	MAPPER	mRatBN7.2
Rnor_6.0	15	81,255,292 - 81,255,430	NCBI	Rnor6.0
Rnor_5.0	15	84,794,264 - 84,794,402	UniSTS	Rnor5.0
RGSC_v3.4	15	80,361,961 - 80,362,100	RGD	RGSC3.4
RGSC_v3.4	15	80,361,962 - 80,362,100	UniSTS	RGSC3.4
RGSC_v3.1	15	80,377,742 - 80,377,880	RGD
Celera	15	72,959,866 - 72,960,004	UniSTS
RH 3.4 Map	X	349.81	UniSTS
RH 3.4 Map	X	349.81	RGD
RH 2.0 Map	21	234.4	RGD
SHRSP x BN Map	15	43.6598	RGD
FHH x ACI Map	15	59.21	RGD
Cytogenetic Map	15		RGD

Is Marker For:

Strains: AVN/Orl BBDP/Rhw BBDR/Rhw BC/CpbU BDIX/Han BDVII/Cub BN/SsNHsd BP/Cub BUF/Pit DA/PitN DON/Melb F344/Pit FHH/Eur IS/Kyo LE/Mol LEW/Pit LH/Mav MHS/Gib MNRA/N WN/N WKY/OlaHsd WTC/Kyo LOU/CHan MNR/N MR/Pit ODU/N WF/Pit WIST/Nhg SR/Jr MNS/Gib NP9 OKA/Wsl OM/Ztm P5C PVG/Pit SD/Rij SHR/OlaHsd SHRSP/Riv WAG/RijKyo GK/KyoSwe M520/N ACI/N BN-Lx/Cub LN/Mav GH/Omr NEDH/K SS/Jr COP/OlaHsd
QTLs: BpQTLcluster12 Bp223 Rf42 Colcr6 Bss65 Aia24

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.	Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3.	Rat Genetic Map Data	Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4.	Electronic Transfer of SSLP Data	Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5.	UniSTS Pipeline	RGD automated pipelines
6.	RH Map Project	RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7.	A high density integrated genetic linkage and radiation hybrid map of the laboratory rat	Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
8.	Electronic Submission of SSLP Data Sets	Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence


Forward Primer	CCTCCAAACATGACAAAGTGG
Reverse Primer	GGCAAAACACCAGTGTCTGC

Strain Variation

Strain, Expected Size(s)

ACI/N	152
AVN/Orl	138
BBDP/Rhw	142
BBDR/Rhw	142
BC/CpbU	150
BDIX/Han	152
BDVII/Cub	152
BN-Lx/Cub	138
BN/SsNHsd	138
BP/Cub	152
BUF/Pit	152
COP/OlaHsd	152
DA/PitN	152

DON/Melb	133
F344/Pit	133
FHH/Eur	150
GH/Omr	150
GK/KyoSwe	150
IS/Kyo	146
LE/Mol	133
LEW/Pit	144
LH/Mav	159
LN/Mav	159
LOU/CHan	144
M520/N	133
MHS/Gib	133

MNR/N	138
MNRA/N	138
MNS/Gib	144
MR/Pit	138
NEDH/K	133
NP9	142
ODU/N	150
OKA/Wsl	150
OM/Ztm	159
P5C	142
PVG/Pit	144
SD/Rij	150
SHR/OlaHsd	150

SHRSP/Riv	150
SR/Jr	159
SS/Jr	159
WAG/RijKyo	144
WF/Pit	142
WIST/Nhg	152
WKY/OlaHsd	138
WN/N	152
WTC/Kyo	150

Region

Nucleotide Sequences


GenBank Nucleotide	DH654336	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	DH769799	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
61424	Scl1	Serum cholesterol level QTL 1	7.7	0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	15	16725528	80672115	Rat
1331729	Rf42	Renal function QTL 42	3.071		kidney blood vessel physiology trait (VT:0100012)	absolute change in renal blood flow rate (CMO:0001168)	15	17362897	73690657	Rat
1578646	Bmd18	Bone mineral density QTL 18	5.2		femur mineral mass (VT:0010011)	trabecular volumetric bone mineral density (CMO:0001729)	15	22806240	98288169	Rat
1578647	Bmd17	Bone mineral density QTL 17	4		femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	15	22806240	98288169	Rat
1578660	Bss19	Bone structure and strength QTL 19	4.3		femur morphology trait (VT:0000559)	bone trabecular cross-sectional area (CMO:0002311)	15	22806240	98288169	Rat
1582214	Stl21	Serum triglyceride level QTL 21	3.1	0.022	blood triglyceride amount (VT:0002644)	serum triglyceride level (CMO:0000360)	15	28030665	82262678	Rat
1582227	Gluco30	Glucose level QTL 30	3.6	0.0003	blood glucose amount (VT:0000188)	absolute change in blood glucose level area under curve (CMO:0002034)	15	28030665	82262678	Rat
1582228	Epfw3	Epididymal fat weight QTL 3	4.1	0.0002	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	15	28030665	82262678	Rat
1582242	Gluco28	Glucose level QTL 28	3.3	0.0008	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	15	28030665	82262678	Rat
1582244	Bw79	Body weight QTL 79	4	0.0002	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	15	28030665	82262678	Rat
1598828	Glom14	Glomerulus QTL 14	2.5		kidney glomerulus morphology trait (VT:0005325)	index of glomerular damage (CMO:0001135)	15	34054139	79054139	Rat
1300144	Rf23	Renal function QTL 23	3.61		renal blood flow trait (VT:2000006)	absolute change in renal vascular resistance (CMO:0001900)	15	40631268	98288169	Rat
724545	Niddm54	Non-insulin dependent diabetes mellitus QTL 54		0.02	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	15	50794494	73699215	Rat
2317050	Aia24	Adjuvant induced arthritis QTL 24	2.06		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	15	52847908	73690657	Rat
1576315	Schws6	Schwannoma susceptibility QTL 6		0.0069	nervous system integrity trait (VT:0010566)	post-insult time of death (CMO:0002005)	15	53806152	98806152	Rat
61477	Aia4	Adjuvant induced arthritis QTL 4	3		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	15	55596089	91365858	Rat
631516	Gluco31	Glucose level QTL 31	7		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	15	55596089	95018120	Rat
631655	Bp126	Blood pressure QTL 126	4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	15	58156477	101769107	Rat
2313080	Bss65	Bone structure and strength QTL 65	3.9	0.0001	long bone metaphysis morphology trait (VT:0000133)	tibia midshaft total cross-sectional area (CMO:0001715)	15	60990468	73690657	Rat
731177	Uae26	Urinary albumin excretion QTL 26	2.4	0.025	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	15	67588667	101769107	Rat
2300326	Plaw1	Placental weight QTL 1	15	0.005	placenta mass (VT:0004257)	placenta wet weight (CMO:0002088)	15	68327165	100062518	Rat
724548	Niddm55	Non-insulin dependent diabetes mellitus QTL 55		0.02	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	15	68327360	73699069	Rat
1331724	Bp223	Blood pressure QTL 223	3.53715		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	15	73690518	95018228	Rat
1641889	Colcr6	Colorectal carcinoma resistance QTL 6	2.9	0.0126	intestine integrity trait (VT:0010554)	benign colorectal tumor surface area measurement (CMO:0001799)	15	73690518	99794247	Rat
70182	BpQTLcluster12	Blood pressure QTL cluster 12	3.53		arterial blood pressure trait (VT:2000000)	absolute change in mean arterial blood pressure (CMO:0000533)	15	73690657	95018120	Rat

Additional Information

RGD Curation Notes

Note Type	Note	Reference

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	100303390	UniSTS
	100306889	UniSTS
	100381235	UniSTS
	326508	UniSTS
	544344	UniSTS
	544349	UniSTS
UniSTS	119302	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D15Mgh8