D11Mgh5 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D11Mgh5

Symbol: D11Mgh5
Previously known as: R1102-B12; R3301; oxsts8824; 
RGD ID: 34150
Expected Size: 242 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01144,444,112 - 44,444,347NCBIRnor6.0
Rnor_5.01147,637,212 - 47,637,447UniSTSRnor5.0
RGSC_v3.41143,156,819 - 43,157,054RGDRGSC3.4
RGSC_v3.41143,156,820 - 43,157,054UniSTSRGSC3.4
RGSC_v3.11143,214,409 - 43,214,643RGD
Celera1142,134,750 - 42,134,984UniSTS
RH 3.4 Map11311.1UniSTS
RH 3.4 Map11311.1RGD
RH 2.0 Map11309.5RGD
SHRSP x BN Map1113.8499RGD
Cytogenetic Map11 RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Niddm50   Bw121   Bp291   Memor7   Scl58  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
8. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer CAGCTCTAATTCCAGAAAGGTTT
Reverse Primer GAATCGATTGACAGATGTCTGTG
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473967 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000241 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100302872 UniSTS
  100303063 UniSTS
  100303387 UniSTS
  387413 UniSTS
  387415 UniSTS
UniSTS 118224 UniSTS