D13Mgh6 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D13Mgh6

Symbol: D13Mgh6
Previously known as: oxsts5530; R3172; 
RGD ID: 34124
Expected Size: 108 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81399,745,300 - 99,745,408 (+)Marker Load Pipeline
mRatBN7.21397,213,755 - 97,213,863 (+)MAPPERmRatBN7.2
Rnor_6.013103,613,626 - 103,613,733NCBIRnor6.0
Rnor_5.013108,279,035 - 108,279,142UniSTSRnor5.0
RGSC_v3.413101,704,193 - 101,704,301RGDRGSC3.4
RGSC_v3.413101,704,194 - 101,704,301UniSTSRGSC3.4
Celera1396,726,130 - 96,726,237UniSTS
RGSC_v3.113101,893,236 - 101,893,344RGD
RH 3.4 Map13656.7RGD
RH 3.4 Map13656.7UniSTS
RH 2.0 Map13716.2RGD
Cytogenetic Map13 RGD
Is Marker For: Strains:   ACI/N   AVN/Orl   BBDR/Rhw   BBDP/Rhw   BC/CpbU   BDIX/Han   BN/SsNHsd   BP/Cub   BUF/Pit   COP/OlaHsd   DA/PitN   FHH/Eur   F344/Pit   GH/Omr   GK/KyoSwe   DON/Melb   M520/N   IS/Kyo   WN/N   LH/Mav   LE/Mol   LEW/Pit   LOU/CHan   LN/Mav   MHS/Gib   MNR/N   MNRA/N   MNS/Gib   MR/Pit   NEDH/K   NP9   ODU/N   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SR/Jr   SHRSP/Riv   SS/Jr   WAG/RijKyo   WF/Pit   WKY/OlaHsd   WTC/Kyo   SHR.SS-(D13Rat1-D13Mgh6)/Mco  
QTLs:   Gluco63   Pur32  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer CACACTGGTTCATCCACAGG
Reverse Primer GAAGCAGGTGATCCTAGAGTGA
 

Region

Nucleotide Sequences
GenBank Nucleotide JH617936.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
7207885Glom27Glomerulus QTL 273.9kidney glomerulus integrity trait (VT:0010546)kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)1321120177109350286Rat
738027Lnnr6Liver neoplastic nodule remodeling QTL 63.3liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)1365613454109350286Rat
7387280Uae43Urinary albumin excretion QTL 435.690.4174urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1368983334109350286Rat
2293702Bss34Bone structure and strength QTL 344.610.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1367635937109350286Rat
1576318Schws5Schwannoma susceptibility QTL 50.0351nervous system integrity trait (VT:0010566)post-insult time to trigeminal nerve neurilemmoma formation (CMO:0002019)1364497900109350286Rat
1354621Rf47Renal function QTL 473.7kidney renin amount (VT:0010559)kidney renin level (CMO:0002166)1311081740103588154Rat
1354655Bp241Blood pressure QTL 2413.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1338975045103588154Rat
8655951Rf63Renal function QTL 6312.2blood urea nitrogen amount (VT:0005265)plasma urea nitrogen level (CMO:0000586)1371610804109350286Rat
4889606Gluco63Glucose level QTL 632.860.003blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1383286150109350286Rat
8655959Pur32Proteinuria QTL 328.4urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)137298450699745408Rat
2293687Bss26Bone structure and strength QTL 264.60.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1367635937109350286Rat
12879475Bp400Blood pressure QTL 400arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1364375743109350286Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131103588154Rat
2293341Glom15Glomerulus QTL 159.1kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1367635937109350286Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100528034 UniSTS