D8Mgh11 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D8Mgh11

Symbol: D8Mgh11
Previously known as: oxsts5296; R2028; 
RGD ID: 34068
Expected Size: 150 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.28105,647,049 - 105,647,213 (+)MAPPERmRatBN7.2
Rnor_6.08113,580,399 - 113,580,562NCBIRnor6.0
Rnor_5.08112,967,026 - 112,967,189UniSTSRnor5.0
RGSC_v3.48110,106,284 - 110,106,448RGDRGSC3.4
RGSC_v3.48110,106,285 - 110,106,448UniSTSRGSC3.4
RGSC_v3.18110,125,739 - 110,125,903RGD
Celera8105,003,697 - 105,003,860UniSTS
RH 3.4 Map81145.3UniSTS
RH 3.4 Map81145.3RGD
RH 2.0 Map8871.2RGD
Cytogenetic Map8q32UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Cia6   Activ1   Pia18  
Genes:   Cpne4  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Genetic dissection of a rat model for rheumatoid arthritis: significant gender influences on autosomal modifier loci Furuya T, etal., Hum Mol Genet 2000 Sep 22;9(15):2241-50
3. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
4. UniSTS Pipeline RGD automated pipelines
5. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
6. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
7. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer CAGCCCATGGGTGGATAATA
Reverse Primer TAGGCACATGCATACGTATCTACA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1308844Cpne4copine 48105177376105653075Rat

Nucleotide Sequences
GenBank Nucleotide CH473954 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000238 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1581557Eae16Experimental allergic encephalomyelitis QTL 163.8nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)88462195110921472Rat
631650Stl6Serum triglyceride level QTL 640.0019blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)810378157112202585Rat
1554321Bmd3Bone mineral density QTL 37.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)840952565123900184Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)846531639119088624Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)846531639119088624Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)846531639119088624Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)846531639119088624Rat
1358912Bw51Body weight QTL 512.95body mass (VT:0001259)body weight (CMO:0000012)851351728107062046Rat
2303171Bp331Blood pressure QTL 3315.570.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)861290298119084929Rat
631653Bp125Blood pressure QTL 1253.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)866142385111142385Rat
631210Bw3Body weight QTL35.9mesenteric fat pad mass (VT:0010427)mesenteric fat pad weight to body weight ratio (CMO:0000654)869349194112783834Rat
1300171Bp184Blood pressure QTL 1843.66arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)870513503118219066Rat
8694446Bw170Body weight QTL 17012.070.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)871888757116888757Rat
9590292Uminl3Urine mineral level QTL 33.620.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)871888757116888757Rat
8694200Abfw4Abdominal fat weight QTL 49.070.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)871888757116888757Rat
8694392Bw161Body weight QTL 1618.060.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)871888757116888757Rat
1549909Stresp11Stress response QTL 116.830.0019stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)873473045118473045Rat
2300181Bmd55Bone mineral density QTL 555.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)876468691121468691Rat
61437Cia6Collagen induced arthritis QTL 6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)882460758122812818Rat
2313400Anxrr25Anxiety related response QTL 25aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)889265192114019816Rat
738011Anxrr9Anxiety related response QTL 96.1exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)893535351123900184Rat
1358893Bp263Blood pressure QTL 2635.01arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)893965141123900184Rat
1358903Bp252Blood pressure QTL 25270.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)893965141123900184Rat
738014Anxrr15Anxiety related response QTL 153.60.005locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)895718998123900184Rat
2300182Bmd56Bone mineral density QTL 565.4femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)895718998123900184Rat
724539Cm19Cardiac mass QTL 192.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)8100149864120994388Rat
631217Activ1Activity QTL 115.9voluntary movement trait (VT:0003491)number of photobeam interruptions in an experimental apparatus (CMO:0001517)8102370617108923645Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 326442 UniSTS
  367160 UniSTS
  369048 UniSTS
  387407 UniSTS
UniSTS 119399 UniSTS