D6Mit8 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D6Mit8

Symbol: D6Mit8
Previously known as: R1150; MIT1150; R1101-C05; oxsts5172; 
RGD ID: 33987
Expected Size: 215 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2693,701,310 - 93,701,509 (+)MAPPERmRatBN7.2
Rnor_6.0697,949,772 - 97,949,970NCBIRnor6.0
Rnor_5.06107,370,981 - 107,371,179UniSTSRnor5.0
RGSC_v3.4697,561,873 - 97,562,072RGDRGSC3.4
RGSC_v3.4697,561,874 - 97,562,072UniSTSRGSC3.4
RGSC_v3.1697,565,330 - 97,565,528RGD
Celera692,136,112 - 92,136,316UniSTS
RH 3.4 Map6656.3UniSTS
RH 3.4 Map6656.3RGD
RH 2.0 Map6861.5RGD
SHRSP x BN Map655.6199RGD
Cytogenetic Map6q24UniSTS
Is Marker For: Strains:   ACI/N   AVN/Orl   BBDR/Rhw   BBDP/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN-Lx/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   COP/OlaHsd   DA/PitN   FHH/Eur   F344/Pit   GH/Omr   GK/KyoSwe   DON/Melb   M520/N   IS/Kyo   WN/N   LH/Mav   LE/Mol   LEW/Pit   LOU/CHan   LN/Mav   MHS/Gib   MNR/N   MNRA/N   MNS/Gib   MR/Pit   NEDH/K   NP9   ODU/N   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SR/Jr   SHRSP/Riv   SS/Jr   WAG/RijKyo   WF/Pit   WIST/Nhg   WKY/OlaHsd   WTC/Kyo   MWF.SHR-(D6Rat1-D6Mit8)/Rkb  
QTLs:   Glom7   Bp212   Rf37  
Genes:   Kcnh5  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
8. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer AGCCTAAAATTTGACTCTCTTTGC
Reverse Primer GGTTCACACCATGGTGATTG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
621417Kcnh5potassium voltage-gated channel subfamily H member 569361517493908107Rat

Nucleotide Sequences
GenBank Nucleotide CH473947 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000236 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
4145119Mcs25Mammary carcinoma susceptibility QTL 250.0001mammary gland integrity trait (VT:0010552)ratio of deaths to total study population during a period of time (CMO:0001023)610894415110548006Rat
1576309Emca7Estrogen-induced mammary cancer QTL 74mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)615107216107351382Rat
634330Pia16Pristane induced arthritis QTL 163.9joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)645790088104200226Rat
6893332Cm74Cardiac mass QTL 740.40.64heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)657730540104085867Rat
1558641Cm47Cardiac mass QTL 472.90.001heart mass (VT:0007028)heart wet weight (CMO:0000069)657730540104085867Rat
70176Mcsm1Mammary carcinoma susceptibility modifier QTL 1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)658632962103632962Rat
12801471Schws9Schwannoma susceptibility QTL 9nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)661747639106747639Rat
731173Uae22Urinary albumin excretion QTL 2210.1urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
2290393Uae37Urinary albumin excretion QTL 370.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
1641904Alcrsp4Alcohol response QTL 4response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)667262953112262953Rat
1300075Glom7Glomerulus QTL 75.60.0000002kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)671201409116201409Rat
1331789Rf37Renal function QTL 373.224kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)672202632115200186Rat
70196BpQTLcluster7Blood pressure QTL cluster 76.82arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)672202632117202632Rat
724536Uae7Urinary albumin excretion QTL 73.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)672202632130729475Rat
1331799Bp211Blood pressure QTL 2113.66407arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)672202632130919985Rat
1581550Pur8Proteinuria QTL 8urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)672227641130729205Rat
1581563Uae33Urinary albumin excretion QTL 33urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)672227641130729205Rat
724524Uae2Urinary albumin excretion QTL 22.70.0005urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)673463459109394713Rat
2293837Kiddil1Kidney dilation QTL 13.7kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)681132889104393926Rat
2293842Kiddil3Kidney dilation QTL 34.3kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)681132889104393926Rat
737827Hcar11Hepatocarcinoma resistance QTL 114.4liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)682523650110548006Rat
1576302Schws4Schwannoma susceptibility QTL 40.0078nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)683190345106747639Rat
738034Anxrr5Anxiety related response QTL 55.9exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)684130881129130881Rat
10054138Gmadr3Adrenal mass QTL 33.680.00045adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)685140138130140138Rat
10054123Srcrt6Stress Responsive Cort QTL 62.50.0043blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)685140138130140138Rat
724513Uae14Urinary albumin excretion QTL 146.5urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)685311061133478515Rat
1300076Glom8Glomerulus QTL 870.000000009kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)686894788131894788Rat
2303624Vencon5Ventilatory control QTL 54.45respiration trait (VT:0001943)minute ventilation (CMO:0000132)688047916133047916Rat
1331722Thshl1Thyroid stimulating hormone level QTL 111.70.0001blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)689762877106752806Rat
1331725Bp212Blood pressure QTL 2123.52475arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)693701310128713626Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 171146 UniSTS
  444902 UniSTS
  544345 UniSTS
  544451 UniSTS
UniSTS 119390 UniSTS