D1Mit7 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Mit7

Symbol: D1Mit7
Previously known as: oxsts4770; R951; 
RGD ID: 33903
Expected Size: 173 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_5.01262,617,194 - 262,617,374NCBIRnor5.0
RGSC_v3.41240,980,142 - 240,980,321RGDRGSC3.4
RGSC_v3.11241,163,531 - 241,163,920RGD
Cytogenetic Map1 RGD
Is Marker For: Strains:   ACI/N   AVN/Orl   BBDR/Rhw   BBDP/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN-Lx/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   COP/OlaHsd   DA/PitN   FHH/Eur   F344/Pit   GH/Omr   GK/KyoSwe   DON/Melb   M520/N   IS/Kyo   WN/N   LH/Mav   LE/Mol   LOU/CHan   LN/Mav   MHS/Gib   MNR/N   MNRA/N   MNS/Gib   MR/Pit   NEDH/K   NP9   ODU/N   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SR/Jr   SHRSP/Riv   SS/Jr   WAG/RijKyo   WF/Pit   WIST/Nhg   WKY/OlaHsd   WTC/Kyo   SBN.SBH-(D1Rat27-D1Mit7)/Ygl   F344.GK-(D1Mit7-D1Mgh25)/Swe  
QTLs:   Eae7   Niddm1   Niddm4   Bw115   Bw61   Rf51   Niddm36  


Annotation


References - curated
# Reference Title Reference Citation
1. Evidence for common autoimmune disease genes controlling onset, severity, and chronicity based on experimental models for multiple sclerosis and rheumatoid arthritis. Bergsteinsdottir K, etal., J Immunol 2000 Feb 1;164(3):1564-8
2. A linkage map of the rat genome derived from three F2 crosses. Bihoreau MT, etal., Genome Res 1997 May;7(5):434-40.
3. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
4. Genetic analysis of non-insulin dependent diabetes mellitus in the GK rat Galli J, etal., Nat Genet 1996 Jan;12(1):31-7
5. UniSTS Pipeline RGD automated pipelines
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer TGAGTTCATCCCAGGACACA
Reverse Primer AACAAAACAAAAATCCCCACC
 

Region

Nucleotide Sequences


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 326350 UniSTS
  326409 UniSTS
  326412 UniSTS
  326560 UniSTS
  369045 UniSTS
  387377 UniSTS
  387448 UniSTS