D3Mit19 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D3Mit19

Symbol: D3Mit19
Previously known as: oxsts9087; 
RGD ID: 33897
Expected Size: 187 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
RGSC_v3.1698,838,518 - 98,838,852RGD
Is Marker For: QTLs:   Bss88   Bss99   Bmd83  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AAAGCAAGGTGGACAGCACT
Reverse Primer GTAGAAGGATGAGACAGCCCC
 

Region

Nucleotide Sequences


Additional Information

Database Acc Id Source(s)
NCBI Gene 100528047 UniSTS
  100861417 UniSTS
  100861420 UniSTS
UniSTS 239588 UniSTS