D16Mit2 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D16Mit2

Symbol: D16Mit2
Previously known as: R1103-B02; R762; oxsts8914; 
RGD ID: 33848
Expected Size: 169 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2164,227,609 - 4,227,730 (+)MAPPERmRatBN7.2
Rnor_6.0165,098,584 - 5,098,704NCBIRnor6.0
Rnor_6.0165,013,802 - 5,013,922NCBIRnor6.0
Rnor_5.0164,954,192 - 4,954,312UniSTSRnor5.0
Rnor_5.0165,038,686 - 5,038,806UniSTSRnor5.0
RGSC_v3.4164,304,396 - 4,304,517RGDRGSC3.4
RGSC_v3.4164,304,397 - 4,304,517UniSTSRGSC3.4
RGSC_v3.1164,304,394 - 4,304,515RGD
Celera1610,945,533 - 10,945,653UniSTS
RH 3.4 Map168.3RGD
RH 3.4 Map168.3UniSTS
SHRSP x BN Map161.1599UniSTS
SHRSP x BN Map161.1599RGD
FHH x ACI Map163.1999RGD
Cytogenetic Map16p16UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   LN/Mav   SS.LEW-(D16Uia2-D16Rat12)/Ayd   SS.LEW-(D16Mit2-D16Rat12)/Ayd   GH/Omr   NEDH/K   SS/Jr   SS.LEW-(D16Mit2-D16Chm23)/Ayd   COP/OlaHsd   SS.LEW-(D16Chm36-D16Mit2)/Ayd  
QTLs:   Bp23   Bp40   Niddm6   BpQTLcluster13   Alc7   Hcas4   Alc13   Alc11   Rends4   Insul8   Kidm69  
Genes:   Cacna2d3  


Annotation


References - curated
# Reference Title Reference Citation
1. Genetic modifiers of Leprfa associated with variability in insulin production and susceptibility to NIDDM. Chung WK, etal., Genomics 1997 May 1;41(3):332-44
2. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
3. Genome scan and congenic strains for blood pressure QTL using Dahl salt-sensitive rats. Garrett MR, etal., Genome Res 1998 Jul;8(7):711-23
4. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
5. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
6. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
7. UniSTS Pipeline RGD automated pipelines
8. A biometrical genome search in rats reveals the multigenic basis of blood pressure variation. Schork NJ, etal., Genome Res 1995 Sep;5(2):164-72
9. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer AACGAGGGGAAATAAGCACC
Reverse Primer ATCCAAACCTGACATCTGGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
631361Cacna2d3calcium voltage-gated channel auxiliary subunit alpha2delta 31640984394912498Rat
9317194LOC103693891uncharacterized LOC1036938911642265054242947Rat

Nucleotide Sequences
GenBank Nucleotide DH597669 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1357403Slep4Serum leptin concentration QTL 43.91blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1619639137Rat
1600369Hcas8Hepatocarcinoma susceptibility QTL 8liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)16122477621Rat
631830Alc7Alcohol consumption QTL 72.9consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16126727669Rat
634355Rends4Renal damage susceptibility QTL 40.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)16126727669Rat
1582235Insul8Insulin level QTL 83.30.0063blood insulin amount (VT:0001560)calculated serum insulin level (CMO:0000359)16126727669Rat
9590151Scort8Serum corticosterone level QTL 88.450.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)16130836262Rat
2302380Slep6Serum leptin concentration QTL 63.36blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)16132139025Rat
2307172Activ4Activity QTL 43.710.00023locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)16133418960Rat
1354584Despr6Despair related QTL 63.10.0067locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16139533930Rat
2303566Bw90Body weight QTL 902body mass (VT:0001259)body weight (CMO:0000012)16139533930Rat
631561Hcuc2Hepatic copper content QTL 22.8liver copper amount (VT:0003065)liver total copper weight (CMO:0001507)16139533949Rat
6903319Bw114Body weight QTL 1142.70.0037body mass (VT:0001259)body weight (CMO:0000012)16143534949Rat
7411664Foco30Food consumption QTL 30110.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)16144588133Rat
1354625Despr7Despair related QTL 73.160.016locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16144977551Rat
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1683223646053497Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
12903955Kidm69Kidney mass QTL 690.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)168323804227609Rat
2301406Kidm39Kidney mass QTL 390.002kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)16285170915884239Rat
1300133Rf24Renal function QTL 243.64blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)16338015021361552Rat
2306902Bp339Blood pressure QTL 3390.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16338015043025077Rat
737825Alc13Alcohol consumption QTL 134.5consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760916039848Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)16422760943025077Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760943025077Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)16422760943025077Rat
737819Hcas4Hepatocarcinoma susceptibility QTL 44.43liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)16422760946975965Rat
61405Niddm6Non-insulin dependent diabetes mellitus QTL 63.660.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)16422760948972724Rat
61338Bp23Blood pressure QTL 234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760949227609Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
61372Bp40Blood pressure QTL 402.2blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)16422773017696785Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100303385 UniSTS
  306243 UniSTS
  326361 UniSTS
  326386 UniSTS
  326414 UniSTS
  326509 UniSTS
  387369 UniSTS
  387428 UniSTS
  408091 UniSTS
  408097 UniSTS
  408098 UniSTS
UniSTS 226759 UniSTS