D3Mit18 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D3Mit18

Symbol: D3Mit18
Previously known as: R745; oxsts9086; 
RGD ID: 33838
Expected Size: 188 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.27116,932,605 - 116,932,728 (+)MAPPERmRatBN7.2
mRatBN7.23112,287,552 - 112,287,746 (+)MAPPERmRatBN7.2
Rnor_6.03117,303,473 - 117,303,664NCBIRnor6.0
Rnor_6.07126,719,006 - 126,719,128NCBIRnor6.0
Rnor_5.03123,827,331 - 123,827,522UniSTSRnor5.0
Rnor_5.07126,429,783 - 126,429,905UniSTSRnor5.0
RGSC_v3.47123,844,340 - 123,844,462UniSTSRGSC3.4
RGSC_v3.43112,334,733 - 112,334,924UniSTSRGSC3.4
Celera7113,223,662 - 113,223,784UniSTS
Celera3111,145,717 - 111,145,908UniSTS
RGSC_v3.13112,240,305 - 112,240,497RGD
Cytogenetic Map7q34UniSTS
Is Marker For: Strains:   ACI/N   AVN/Orl   BBDR/Rhw   BBDP/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN-Lx/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   COP/OlaHsd   DA/PitN   FHH/Eur   F344/Pit   GH/Omr   GK/KyoSwe   DON/Melb   M520/N   IS/Kyo   WN/N   LH/Mav   LE/Mol   LEW/Pit   LOU/CHan   LN/Mav   MHS/Gib   MNR/N   MNRA/N   MNS/Gib   MR/Pit   NEDH/K   NP9   ODU/N   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SR/Jr   SHRSP/Riv   SS/Jr   WAG/RijKyo   WF/Pit   WIST/Nhg   WKY/OlaHsd   WTC/Kyo  
QTLs:   Bp207  
Genes:   Ttc38  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines
3. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer CCAGGTCAAACTCCTCTCCA
Reverse Primer AGCCAGAAGATTAGAACATATTGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1306041Ttc38tetratricopeptide repeat domain 387116925273116948616Rat



QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)743747012135012528Rat
1300112Bp183Blood pressure QTL 1833.51arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)7111182207135012528Rat
1331728Bp214Blood pressure QTL 2142.825arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)780221299124373579Rat
1331731Bp216Blood pressure QTL 2162.851arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)7102297359133492884Rat
2298475Eau6Experimental allergic uveoretinitis QTL 60.0029uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)784257275129257275Rat
71114Niddm14Non-insulin dependent diabetes mellitus QTL 144.5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)784257275129257275Rat
631687Hcas1Hepatocarcinoma susceptibility QTL 13.90.001liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)791412594129807172Rat
1357339Stl14Serum triglyceride level QTL 143.450.0001blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)7112729683133492707Rat
634331Pia17Pristane induced arthritis QTL 174.7joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)773829340130221005Rat
1358914Bp266Blood pressure QTL 266arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)783591953134666232Rat
631504Cm27Cardiac mass QTL 273.45heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)744421311118198041Rat
634322Bw12Body weight QTL 120body mass (VT:0001259)body weight (CMO:0000012)783153392128153392Rat
70173Niddm19Non-insulin dependent diabetes mellitus QTL 194.330.00005blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)764002457135012528Rat
1549899Stresp8Stress response QTL 84.370.0008stress-related behavior trait (VT:0010451)defensive burying duration (CMO:0001961)790482196135012528Rat
2317052Aia17Adjuvant induced arthritis QTL 172.13joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)781737938126737938Rat
731176Glom5Glomerulus QTL 52.50.0035kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)796670164135012528Rat
7411607Foco15Food consumption QTL 150.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)775918751120918751Rat
2306821Bp335Blood pressure QTL 3350.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7106571501135012528Rat
631663Bw6Body weight QTL 63.4body mass (VT:0001259)body weight (CMO:0000012)7111075573134976056Rat
1558655Swd4Spike wave discharge measurement QTL 43.680.0002brain electrophysiology trait (VT:0010557)brain spike-and-wave discharge severity grade (CMO:0001988)786983365131983365Rat
631201Panci1Pancreas inflammation QTL 100.001pancreas integrity trait (VT:0010560)percentage of study population displaying chronic pancreatitis at a point in time (CMO:0001214)7116677189127103496Rat
1331768Kidm10Kidney mass QTL 104.62096kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)780221299125221299Rat
61357Bp38Blood pressure QTL 381.60.052arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)741333674119109060Rat
731174Uae23Urinary albumin excretion QTL 232.40.0042urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)7104603555135012528Rat
1331748Bp215Blood pressure QTL 2154.043arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)7112308254133492884Rat
7411654Foco25Food consumption QTL 259.30.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)775918751120918751Rat
2299163Iddm34Insulin dependent diabetes mellitus QTL 342.71blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)791281130135012528Rat
1582240Sffal1Serum free fatty acids level QTL 13.40.0021blood free fatty acid amount (VT:0001553)serum free fatty acids level (CMO:0000547)7116677010124049952Rat
631540Bw9Body weight QTL 94.5body mass (VT:0001259)body weight (CMO:0000012)769736226117455174Rat
1358891Bp265Blood pressure QTL 2652.21arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)783591953134666232Rat
1300112Bp183Blood pressure QTL 1833.51arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)7111182207135012528Rat
1331728Bp214Blood pressure QTL 2142.825arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)780221299124373579Rat
1582238Bw68Body weight QTL 683.20.0064body mass (VT:0001259)body weight (CMO:0000012)353184593115665732Rat
2302373Gluco39Glucose level QTL 395.01blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)398535386161695835Rat
1331731Bp216Blood pressure QTL 2162.851arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)7102297359133492884Rat
1582239Epfw1Epididymal fat weight QTL 14.50.0006epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)353184593115665732Rat
631687Hcas1Hepatocarcinoma susceptibility QTL 13.90.001liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)791412594129807172Rat
1358362Srcrt2Stress Responsive Cort QTL 22.78blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)338192233133483320Rat
1357339Stl14Serum triglyceride level QTL 143.450.0001blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)7112729683133492707Rat
1582216Bw65Body weight QTL 656.3body mass (VT:0001259)body weight (CMO:0000012)3102200529115665732Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)329463235118376539Rat
1582218Bw74Body weight QTL 743.90.0021body mass (VT:0001259)body weight (CMO:0000012)353184593115665732Rat
1582219Bw63Body weight QTL 633.80.001body mass (VT:0001259)body weight (CMO:0000012)396127817115665732Rat
1582221Kidm30Kidney mass QTL 303.50.0008kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)364655305115665732Rat
1581568Rf53Renal function QTL 53urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)356395968161299569Rat
1582210Bw71Body weight QTL 713.30.0012body mass (VT:0001259)body weight (CMO:0000012)364655305115665732Rat
70173Niddm19Non-insulin dependent diabetes mellitus QTL 194.330.00005blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)764002457135012528Rat
1300111Rf12Renal function QTL 123.78renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)361017749121056321Rat
724523Tsu1Thymus enlargement suppressive QTL 13.84thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)350437504115638231Rat
8694437Bw167Body weight QTL 16722.460.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)391797474136797474Rat
731176Glom5Glomerulus QTL 52.50.0035kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)796670164135012528Rat
8662816Vetf4Vascular elastic tissue fragility QTL 44renal artery integrity trait (VT:0010642)number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563)359242096157323038Rat
2306821Bp335Blood pressure QTL 3350.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7106571501135012528Rat
1581503Cm58Cardiac mass QTL 582.70.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)343827364121056321Rat
631201Panci1Pancreas inflammation QTL 100.001pancreas integrity trait (VT:0010560)percentage of study population displaying chronic pancreatitis at a point in time (CMO:0001214)7116677189127103496Rat
631841Niddm39Non-insulin dependent diabetes mellitus QTL 393.36blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)394856903159898684Rat
1331768Kidm10Kidney mass QTL 104.62096kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)780221299125221299Rat
12879848Bw181Body weght QTL 1810.015body mass (VT:0001259)body weight (CMO:0000012)370348525121056321Rat
61357Bp38Blood pressure QTL 381.60.052arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)741333674119109060Rat
731174Uae23Urinary albumin excretion QTL 232.40.0042urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)7104603555135012528Rat
1331748Bp215Blood pressure QTL 2154.043arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)7112308254133492884Rat
2301971Cm71Cardiac mass QTL 714.63heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)341874578155617519Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
2301970Bw81Body weight QTL 815.19body mass (VT:0001259)body weight (CMO:0000012)341874578155617519Rat
7411654Foco25Food consumption QTL 259.30.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)775918751120918751Rat
2299163Iddm34Insulin dependent diabetes mellitus QTL 342.71blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)791281130135012528Rat
1582240Sffal1Serum free fatty acids level QTL 13.40.0021blood free fatty acid amount (VT:0001553)serum free fatty acids level (CMO:0000547)7116677010124049952Rat
1331758Bp207Blood pressure QTL 2072.848arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)3112287552135181505Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
1358891Bp265Blood pressure QTL 2652.21arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)783591953134666232Rat
724532Cm17Cardiac mass QTL 172heart mass (VT:0007028)calculated heart weight (CMO:0000073)395735366140735366Rat
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)743747012135012528Rat
2312673Scl63Serum cholesterol level QTL 630.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)398535255168026850Rat
2301414Kidm37Kidney mass QTL 370.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)370653097121056321Rat
2298475Eau6Experimental allergic uveoretinitis QTL 60.0029uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)784257275129257275Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)331172320163586636Rat
71114Niddm14Non-insulin dependent diabetes mellitus QTL 144.5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)784257275129257275Rat
2292591Esta4Estrogen-induced thymic atrophy QTL 4thymus mass (VT:0004954)thymus wet weight (CMO:0000855)347233211147415807Rat
634331Pia17Pristane induced arthritis QTL 174.7joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)773829340130221005Rat
1358914Bp266Blood pressure QTL 266arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)783591953134666232Rat
631504Cm27Cardiac mass QTL 273.45heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)744421311118198041Rat
7387306Bw124Body weight QTL 1243.20.0003body mass (VT:0001259)body weight (CMO:0000012)384091273129091273Rat
634322Bw12Body weight QTL 120body mass (VT:0001259)body weight (CMO:0000012)783153392128153392Rat
1549899Stresp8Stress response QTL 84.370.0008stress-related behavior trait (VT:0010451)defensive burying duration (CMO:0001961)790482196135012528Rat
2317052Aia17Adjuvant induced arthritis QTL 172.13joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)781737938126737938Rat
1600376Arunc5Aerobic running capacity QTL 50.21exercise endurance trait (VT:0002332)longest distance run on treadmill (CMO:0001406)373376539118376539Rat
2302273Gluco35Glucose level QTL 355.30.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)380800231114297550Rat
1559282Emca5Estrogen-induced mammary cancer QTL 53.9mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)343827364169034231Rat
7411607Foco15Food consumption QTL 150.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)775918751120918751Rat
631663Bw6Body weight QTL 63.4body mass (VT:0001259)body weight (CMO:0000012)7111075573134976056Rat
1354611Despr2Despair related QTL 23.030.0028locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)397084464142084464Rat
1558655Swd4Spike wave discharge measurement QTL 43.680.0002brain electrophysiology trait (VT:0010557)brain spike-and-wave discharge severity grade (CMO:0001988)786983365131983365Rat
631649Bp123Blood pressure QTL 1233.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)389772419134772419Rat
619618Rf3Renal disease susceptibility QTL 36.50.001urine albumin amount (VT:0002871)urine albumin excretion rate to body weight ratio (CMO:0001270)3107693393152693393Rat
2312659Slep7Serum leptin concentration QTL 70.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)398535255168026850Rat
1581546Pur13Proteinuria QTL 132.930.0335urine total protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)378196190146592722Rat
631665Bw8Body weight QTL 85.5body mass (VT:0001259)body weight (CMO:0000012)350437042119183768Rat
631540Bw9Body weight QTL 94.5body mass (VT:0001259)body weight (CMO:0000012)769736226117455174Rat
2293087Iddm27Insulin dependent diabetes mellitus QTL 272.68blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)397551417147415807Rat
2312670Bw94Body weight QTL 940.01inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)398535255168026850Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 300125 UniSTS
  544378 UniSTS