D1Mit32 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Mit32

Symbol: D1Mit32
Previously known as: oxsts9009; R0202-C08; 
RGD ID: 33830
Expected Size: 149 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21244,113,147 - 244,113,296 (+)MAPPERmRatBN7.2
Rnor_6.01265,002,587 - 265,002,735NCBIRnor6.0
Rnor_5.01272,443,216 - 272,443,364UniSTSRnor5.0
RGSC_v3.41250,430,357 - 250,430,505UniSTSRGSC3.4
RGSC_v3.41250,430,356 - 250,430,505RGDRGSC3.4
RGSC_v3.11250,690,926 - 250,691,074RGD
Celera1239,924,098 - 239,924,246UniSTS
RH 3.4 Map11623.2RGD
RH 3.4 Map11623.2UniSTS
RH 2.0 Map11220.0RGD
SHRSP x BN Map1139.09RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   ACI/N   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   WKY.GHS-(D1Rat32-D1Mit32)  
QTLs:   Hc6  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer GGGAGCAATTGAGGAAAACA
Reverse Primer CTGGGAGAGCAAGGAGTCC
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473986 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000231 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1578778Pur4Proteinuria QTL 43.30.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
631690Scl5Serum cholesterol level QTL 52.1blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1236125214260522016Rat
1354652Kidm20Kidney mass QTL 204.3kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1177227632256448636Rat
2293674Bss39Bone structure and strength QTL 397.10.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)1201554356246554356Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
61327Eae7Experimental allergic encephalomyelitis QTL 75.6body mass (VT:0001259)change in body weight (CMO:0002045)1216255568260522016Rat
1600392Bw123Body weight QTL 1230.001body mass (VT:0001259)body weight (CMO:0000012)1223201027260522016Rat
1578763Kidm29Kidney mass QTL 293.30.0001kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1179567751260522016Rat
1600395Niddm69Non-insulin dependent diabetes mellitus QTL 694.140.0002blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1195804352257091168Rat
1354624Cm35Cardiac mass QTL355.7heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1177227632256448636Rat
1600396Niddm68Non-insulin dependent diabetes mellitus QTL 684.970.0003blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
631837Niddm35Non-insulin dependent diabetes mellitus QTL 350.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1238699859259647894Rat
1600397Edcs4Endometrial carcinoma susceptibility QTL 42.2uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)1206081677251081677Rat
631836Stl31Serum triglyceride level QTL 314.645e-06blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)1237147813260522016Rat
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1153136852260522016Rat
1600388Niddm67Non-insulin dependent diabetes mellitus QTL 675.840.000004blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
2293694Bss38Bone structure and strength QTL 387.050.0001femur strength trait (VT:0010010)femur stiffness (CMO:0001674)1201554356246554356Rat
1578759Uae30Urinary albumin excretion QTL 303.30.003urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1150700247252085048Rat
1300108Rf8Renal function QTL 83.75renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)1228581588259647894Rat
734767Niddm57Non-insulin dependent diabetes mellitus QTL 57body mass (VT:0001259)body weight (CMO:0000012)1224054293260122809Rat
1358898Bp255Blood pressure QTL 2553.6arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1191019702246062233Rat
631215Stl8Serum triglyceride level QTL 89.270.0001blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1225126575260522016Rat
631843Bw116Body weight QTL 1164.10.016abdominal adipose amount (VT:1000220)abdominal fat pad weight (CMO:0000088)1224054293260122809Rat
2300175Bmd40Bone mineral density QTL 4015.40.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)1201554356246554356Rat
731175Uae20Urinary albumin excretion QTL 203.50.0018urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1221264111259647894Rat
1354661Bw33Body weight QTL 335.2body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
724538Kidm1Kidney mass QTL 13.2kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1213707201252085212Rat
2293655Bss36Bone structure and strength QTL 3610.660.0001femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)1201554356246554356Rat
724531Uae5Urinary albumin excretion QTL 54urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)1150700142252085212Rat
734769Niddm58Non-insulin dependent diabetes mellitus QTL 58body mass (VT:0001259)body weight (CMO:0000012)1224569538260122809Rat
734768Niddm59Non-insulin dependent diabetes mellitus QTL 59body mass (VT:0001259)body weight (CMO:0000012)1213843987258843987Rat
1358890Bp259Blood pressure QTL 2593.06arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1210702053260522016Rat
724533Rf51Renal function QTL 515.30.0002kidney plasma flow trait (VT:0005524)renal plasma flow (CMO:0001914)1218753816256448513Rat
1354580Scort1Serum corticosterone level QTL 13.4blood corticosterone amount (VT:0005345)blood corticosterone level (CMO:0001172)1156677124256448636Rat
634313Niddm43Non-insulin dependent diabetes mellitus QTL 43blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1199050459259647894Rat
1549910Bw54Body weight QTL 540.05body mass (VT:0001259)body weight (CMO:0000012)1214647894259647894Rat
70211Niddm24Non-insulin dependent diabetes mellitus QTL 243.79blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1214647894259647894Rat
1357399Bw45Body weight QTL 453.05body mass (VT:0001259)body mass index (BMI) (CMO:0000105)1206329708251329708Rat
724552Glom2Glomerulus QTL 23.30.0001kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)1222363780260522016Rat
2316896Gluco57Glucose level QTL 577.2blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1228985440245907899Rat
1357404Bw42Body weight QTL 424.490.0001body mass (VT:0001259)body weight (CMO:0000012)1206329708251329708Rat
10053715Scort24Serum corticosterone level QTL 242.130.0088blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1221414816260522016Rat
61400Niddm1Non-insulin dependent diabetes mellitus QTL 111blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1218753689245907899Rat
10059587Bw173Body weight QTL 1733.230.025body mass (VT:0001259)body weight (CMO:0000012)1202069611247069611Rat
1354610Bw34Body weight QTL 344.1body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
7387289Uae45Urinary albumin excretion QTL 452.860.0021urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1223262787260522016Rat
1581544Rf52Renal function QTL 520.05urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)1232156370259647894Rat
1600363Hc6Hypercalciuria QTL 62.7urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1203995416244113296Rat
631536Lnnr2Liver neoplastic nodule remodeling QTL 22.90.0005liver integrity trait (VT:0010547)liver remodeling tumorous lesion number to liver total tumorous lesion number ratio (CMO:0001705)1233948574260522016Rat
738032Hcas5Hepatocarcinoma susceptibility QTL 53.12liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1176426412257976495Rat
2302040Pia35Pristane induced arthritis QTL 353.80.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)1216255568260522016Rat
631669Iddm9Insulin dependent diabetes mellitus QTL 92.80.039blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1233190394258625266Rat
7394701Uae46Urinary albumin excretion QTL 463.60.0056urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1201554356246554356Rat
1598821Rf55Renal function QTL 556.3renal blood flow trait (VT:2000006)ratio of change in renal blood flow to change in renal perfusion pressure (CMO:0001239)1218748008257976495Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100302894 UniSTS