D4Mit14 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D4Mit14

Symbol: D4Mit14
Previously known as: oxsts5044; R526; MIT526; 
RGD ID: 33768
Expected Size: 150 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_5.04226,467,963 - 226,468,114NCBIRnor5.0
Rnor_5.04230,803,731 - 230,803,873NCBIRnor5.0
Rnor_5.04226,319,261 - 226,319,403NCBIRnor5.0
Rnor_5.04226,682,059 - 226,682,213NCBIRnor5.0
RGSC_v3.44165,174,287 - 165,174,437RGDRGSC3.4
RGSC_v3.44164,691,265 - 164,691,406RGDRGSC3.4
RGSC_v3.44164,772,647 - 164,772,800RGDRGSC3.4
RGSC_v3.14165,017,584 - 165,017,736RGD
RH 3.4 Map41013.22RGD
RH 3.4 Map41013.22UniSTS
RH 2.0 Map41059.1RGD
Cytogenetic Map4 RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Cia13   Ciaa4  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Genetic dissection of a rat model for rheumatoid arthritis: significant gender influences on autosomal modifier loci Furuya T, etal., Hum Mol Genet 2000 Sep 22;9(15):2241-50
3. Identification of four new quantitative trait loci regulating arthritis severity and one new quantitative trait locus regulating autoantibody production in rats with collagen-induced arthritis. Griffiths MM, etal., Arthritis Rheum 2000 Jun;43(6):1278-89
4. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
8. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer AGGACAGGTTTTTGGGCTTT
Reverse Primer TCTGCCGCCACCTTAGAG
 

Region

Nucleotide Sequences
GenBank Nucleotide JH614816.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH614820.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 326430 UniSTS
  326453 UniSTS
UniSTS 119289 UniSTS