D2Mit10 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D2Mit10

Symbol: D2Mit10
Previously known as: R504; MIT504; oxsts4876; D12Mit11; 
RGD ID: 33747
Expected Size: 121 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.22150,341,585 - 150,341,684 (+)MAPPERmRatBN7.2
Rnor_6.02157,914,311 - 157,914,409NCBIRnor6.0
Rnor_5.02177,277,106 - 177,277,204UniSTSRnor5.0
RGSC_v3.42155,920,709 - 155,920,808RGDRGSC3.4
RGSC_v3.42155,920,710 - 155,920,808UniSTSRGSC3.4
RGSC_v3.12155,870,673 - 155,870,771RGD
Celera2144,750,519 - 144,750,617UniSTS
RH 3.4 Map2970.7UniSTS
RH 3.4 Map2970.7RGD
RH 2.0 Map2705.1RGD
Cytogenetic Map2q31UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BDIX/Han   BDVII/Cub   BN/SsNHsd   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Memor8   Bp101  
Genes:   Veph1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer AAAGTGGGACAGGACACTGG
Reverse Primer GTCACATGGTAAGATGACCTATAGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1308217Veph1ventricular zone expressed PH domain-containing 12150291379150537491Rat

Nucleotide Sequences
GenBank Nucleotide AU027506 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH613603.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1358894Kidm24Kidney mass QTL 244.03kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358899Kidm23Kidney mass QTL 233.88kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358901Cm38Cardiac mass QTL 382heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1358904Cm39Cardiac mass QTL 392.26heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1358910Kidm27Kidney mass QTL 275.77kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358911Kidm28Kidney mass QTL 285.42kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1358887Bw50Body weight QTL 502.39body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
1358908Bw49Body weight QTL 493.36body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
2293835Kiddil5Kidney dilation QTL 53.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242804607157142209Rat
2293843Kiddil6Kidney dilation QTL 63.1kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242804607182042367Rat
1298074Bp164Blood pressure QTL 1640.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
1298085Bp165Blood pressure QTL 1650.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)243154682202446871Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)243154682202446871Rat
1354601Slep1Serum leptin concentration QTL 15.39blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)243171017184114403Rat
631266Bp132Blood pressure QTL 1320.0005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)246123260202447032Rat
1331760Bp206Blood pressure QTL 2063.62454arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)256043031202447032Rat
1298080Bp163Blood pressure QTL 1630.02arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118275202447032Rat
1354648Bp239Blood pressure QTL 2390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118463226797303Rat
1558653Prcr1Prostate cancer resistance QTL 15prostate integrity trait (VT:0010571)area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899)272532993157142209Rat
1354605Rf48Renal function QTL 482.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)274786664206665859Rat
631198Cm22Cardiac mass QTL 224.30.0008heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)276539322150540526Rat
61374Edpm2Estrogen-dependent pituitary mass QTL 24.420.86pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)276539322202447032Rat
1581569Uae32Urinary albumin excretion QTL 320.0001urine protein amount (VT:0005160)urine albumin excretion rate (CMO:0000757)278665619219826953Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)278665619249053267Rat
8662832Vetf7Vascular elastic tissue fragility QTL 73.5aorta elastin amount (VT:0003905)aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)281689826221035911Rat
1354622Kidm16Kidney mass QTL 163kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)281754530222436696Rat
1354649Kidm17Kidney mass QTL 172.9kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)281754530227146641Rat
631507Bp105Blood pressure QTL 1050.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2112456140212696837Rat
634308Sach6Saccharin preference QTL 64.9taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)2112456140212696837Rat
1354594Despr10Despair related QTL 100.00000249locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)2114654253159654253Rat
1359030Bp277Blood pressure QTL 277arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2114837527185876470Rat
1359030Bp277Blood pressure QTL 277arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2114837527185876470Rat
1578648Bss11Bone structure and strength QTL 114.7femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)2114837527211674221Rat
1554319Bmd2Bone mineral density QTL 213.40.0001lumbar vertebra area (VT:0010570)lumbar vertebra cross-sectional area (CMO:0001689)2114837675212549332Rat
1582257Gluco21Glucose level QTL 213.10.0035blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2118111229157142209Rat
738007Anxrr7Anxiety related response QTL 74.4exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)2118189491163189491Rat
1358360Sradr2Stress Responsive Adrenal Weight QTL 210.24adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)2129164097152195315Rat
6907363Bp357Blood pressure QTL 3574.10.002arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2129540907174540907Rat
1300165Rf9Renal function QTL 93.28kidney glomerulus integrity trait (VT:0010546)index of glomerular damage (CMO:0001135)2133914684202447032Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2135552573202446871Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2135552573202446871Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2135552573202446871Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)2135552573202446871Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)2135552573202446871Rat
1298076Bp166Blood pressure QTL 1660.0009arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2136445150202447032Rat
1581502Esta3Estrogen-induced thymic atrophy QTL 3thymus mass (VT:0004954)thymus wet weight (CMO:0000855)2136916935189599348Rat
1359022Ppulsi1Prepulse inhibition QTL 13.63prepulse inhibition trait (VT:0003088)acoustic startle response measurement (CMO:0001519)2136916935213594495Rat
1331794Bp202Blood pressure QTL 2023.66819arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2141194931223265385Rat
1331805Cm29Cardiac mass QTL 293.50746heart mass (VT:0007028)heart wet weight (CMO:0000069)2141194931223265385Rat
71113Cari2Carrageenan-induced inflammation QTL 22.70.009hypodermis integrity trait (VT:0010550)inflammatory exudate volume (CMO:0001429)2141596551202447032Rat
1549828Bp258Blood pressure QTL 2580.03arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2142323368150650069Rat
724568Uae13Urinary albumin excretion QTL 134.4urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)2143157029210020885Rat
10043136Iddm54Insulin dependent diabetes mellitus QTL 543.40.0001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2143657411190602963Rat
10043136Iddm54Insulin dependent diabetes mellitus QTL 543.40.0001blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)2143657411190602963Rat
6903312Bw112Body weight QTL 1123.20.0013body mass (VT:0001259)body weight (CMO:0000012)2143657569184114274Rat
61401Niddm2Non-insulin dependent diabetes mellitus QTL 24.54blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2144599348189599348Rat
631520Bp73Blood pressure QTL 730.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2147686913168355276Rat
1598833Bp295Blood pressure QTL 2953.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2147798556192798556Rat
1641925Alcrsp2Alcohol response QTL 2response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2149559561221167075Rat
1641891Alcrsp17Alcohol response QTL 17response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2149559561249053267Rat
1598805Memor8Memory QTL 83exploratory behavior trait (VT:0010471)average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)2150341585189039377Rat
631501Bp101Blood pressure QTL 1012.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2150341684202446871Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100302871 UniSTS
  361954 UniSTS
  369070 UniSTS
UniSTS 119584 UniSTS