D20Yum48 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D20Yum48

Symbol: D20Yum48
Previously known as: UniSTS:526148; 
RGD ID: 2303287
Expected Size: 192 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2203,626,827 - 3,627,019 (+)MAPPERmRatBN7.2
mRatBN7.2203,626,827 - 3,627,019 (-)MAPPERmRatBN7.2
Rnor_6.0205,186,993 - 5,187,184NCBIRnor6.0
Rnor_6.0204,860,645 - 4,860,836NCBIRnor6.0
Rnor_5.0206,941,045 - 6,941,236UniSTSRnor5.0
RGSC_v3.4203,665,816 - 3,666,007UniSTSRGSC3.4
Celera204,398,471 - 4,398,662UniSTS
Cytogenetic Map20p12UniSTS
Is Marker For: Genes:   Clic1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines
2. An informative set of SSLP markers and genomic profiles in the rat MHC, the RT1 complex. Takagi Y, etal., Immunogenetics. 2008 Dec 24.

Strains and Sequence

Sequence
 
Forward Primer GGACAAAGCTCTGTGGGGTA
Reverse Primer TTCCAGGTGACCCAGGACTA
 

Region



QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61472Aia1Adjuvant induced arthritis QTL 1180.001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)2026463954597031Rat
2306850Pia40Pristane induced arthritis QTL 400.0001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)2015279595304575Rat
1641915Colcr9Colorectal carcinoma resistance QTL 92.970.0024intestine integrity trait (VT:0010554)benign colorectal tumor number (CMO:0001795)20153065546530655Rat
2317057Aia27Adjuvant induced arthritis QTL 272.83joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)20289259726381954Rat
7387283Uae44Urinary albumin excretion QTL 440.1712urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)20126123605Rat
7411668Foco32Food consumption QTL 3280.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)20136600972Rat
2305926Iddm37Insulin dependent diabetes mellitus QTL 376blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)20152784246527842Rat
1354642Despr15Despair related QTL 150.0027locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)20124159021Rat
1600382Edcs3Endometrial carcinoma susceptibility QTL33.50.003uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)20125159026Rat
61448Ciaa1CIA Autoantibody QTL 1300.001blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)2026463954597031Rat
1331772Cdexp2CD45RC expression in CD8 T cells QTL 25.7CD8-positive T cell quantity (VT:0008077)blood CD45RC(high) CD8 T cell count to CD45RC(low) CD8 T cell count ratio (CMO:0001990)20362164910078919Rat
8694189Bw153Body weight QTL 1533.130.001body mass (VT:0001259)body weight gain (CMO:0000420)20129191651Rat
1300152Bp195Blood pressure QTL 1953.46arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2036216499243559Rat
9590109Sffal8Serum free fatty acids level QTL 85.320.01blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)20129191651Rat
9590275Scort15Serum corticosterone level QTL 153.480.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)20129191651Rat
9589155Insul32Insulin level QTL 326.380.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)20129191651Rat
7411650Foco23Food consumption QTL 2320.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)20129191651Rat
2317851Alcrsp22Alcohol response QTL 223.20.05response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)20127339237Rat
1598816Memor12Memory QTL 122.4exploratory behavior trait (VT:0010471)average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)20260683647606836Rat
61432Cia1Collagen induced arthritis QTL 1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)20362165614101050Rat
1641893Alcrsp7Alcohol response QTL 7response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)20127339237Rat
6893685Bw111Body weight QTL 1112.70.004body mass (VT:0001259)body weight (CMO:0000012)20132578807Rat
9590252Scort12Serum corticosterone level QTL 1220.460.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)20136600972Rat
737973Pia21Pristane induced arthritis QTL 214.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)2036216564606812Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 406864 UniSTS