D9Mco85 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D9Mco85

Symbol: D9Mco85
Previously known as: UniSTS:526189; 
RGD ID: 2302927
Expected Size: 200 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2978,594,966 - 78,595,166 (+)MAPPERmRatBN7.2
Rnor_6.0982,890,421 - 82,890,620NCBIRnor6.0
Rnor_5.0982,659,682 - 82,659,881UniSTSRnor5.0
RGSC_v3.4976,455,867 - 76,456,066UniSTSRGSC3.4
Celera976,131,308 - 76,131,507UniSTS
Cytogenetic Map9 RGD
Is Marker For: Strains:   SS.SHR-(D9Wox16-D9Mco85)/Mco  
QTLs:   Bp333  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines
2. Blood pressure and proteinuria effects of multiple quantitative trait loci on rat chromosome 9 that differentiate the spontaneously hypertensive rat from the Dahl salt-sensitive rat. Toland EJ, etal., J Hypertens. 2008 Nov;26(11):2134-41.

Strains and Sequence

Sequence
 
Forward Primer CTTACCTCCCAAGTGCCAGA
Reverse Primer ATGCAGGGGCACATACCTAC
 
Strain Variation
Strain, Expected Size(s)
SS/JrTol0


Region

Nucleotide Sequences


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
10054125Srcrt7Stress Responsive Cort QTL 73.330.0011blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)9187073594Rat
70186Niddm26Non-insulin dependent diabetes mellitus QTL 263.87blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)92207116986369743Rat
7207814Bmd91Bone mineral density QTL 913.5femur size trait (VT:1000369)femoral neck cross-sectional area (CMO:0001697)92375414483851531Rat
70218Cm28Cardiac mass QTL 288.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)92526804479271759Rat
724544Uae9Urinary albumin excretion QTL 94.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)925268044114175309Rat
731164Uae25Urinary albumin excretion QTL 253.50.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)925661188100929786Rat
8662828Vetf6Vascular elastic tissue fragility QTL 63.9artery integrity trait (VT:0010639)patent ductus arteriosus score (CMO:0002566)93696235992058970Rat
2290450Scl57Serum cholesterol level QTL 574.15blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)93696235995410867Rat
6903941Pur31Proteinuria QTL 310.036urine total protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)94019418885194188Rat
11353949Bp393Blood pressure QTL 393arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)94019418885194188Rat
61352Bp34Blood pressure QTL 345arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)94249534379271511Rat
10058949Gmadr5Adrenal mass QTL 520.014adrenal gland mass (VT:0010420)both adrenal glands wet weight to body weight ratio (CMO:0002411)94279151387976209Rat
11353951Bp394Blood pressure QTL 394arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)94464992189649921Rat
12879506Pur33Proteinuria QTL 33urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)94464992189649921Rat
11353957Bmd92Bone mineral density QTL 920.01tibia mineral mass (VT:1000283)volumetric bone mineral density (CMO:0001553)94611419991114199Rat
631656Bp108Blood pressure QTL 1085.970.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)94859825193598251Rat
2303180Bp333Blood pressure QTL 3330.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)95662771378595166Rat
2303180Bp333Blood pressure QTL 3330.001arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)95662771378595166Rat
2303180Bp333Blood pressure QTL 3330.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)95662771378595166Rat
1578760Cm53Cardiac mass QTL 533.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)956771635101771635Rat
724515Uae16Urinary albumin excretion QTL 168urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)958163035100929646Rat
1300134Bp185Blood pressure QTL 1853.73arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)961381434104821652Rat
1581580Uae34Urinary albumin excretion QTL 34urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)96207227596470995Rat
1578757Pur6Proteinuria QTL 63.30.005urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)96207227596470995Rat
61385Edpm9Estrogen-dependent pituitary mass QTL 93.430.05pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)963869687108869687Rat
731171Glom6Glomerulus QTL 62.80.0003kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)964573531109573531Rat
1354626Bvd1Brain ventricular dilatation QTL 13.730.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)975712843111552878Rat
4889852Pur26Proteinuria QTL 26150.001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)977813894101597663Rat
7794784Mcs31Mammary carcinoma susceptibility QTL 312.98mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)977813894111552878Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100302999 UniSTS
UniSTS 526189 UniSTS