D13Hmgc98 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D13Hmgc98

Symbol: D13Hmgc98
Also known as: SCOR_13_5798; 
RGD ID: 1582018
Expected Size: 183 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21339,509,733 - 39,509,916 (+)MAPPER
Rnor_6.01344,729,975 - 44,730,157NCBIRnor6.0
Rnor_5.01349,814,584 - 49,814,766UniSTSRnor5.0
RGSC_v3.41340,716,193 - 40,716,375UniSTSRGSC3.4
Celera1339,883,776 - 39,883,958UniSTS
Cytogenetic Map13q12UniSTS
Is Marker For: Genes:   Zranb3  


Annotation



Strains and Sequence

Sequence
 
Forward Primer CTCTCTCCAGCCTCCCTCTT
Reverse Primer CCAGGTTTGATTAAGGTGCTC
 
Strain Variation
Strain, Expected Size(s)
BN/NHsdMcwi185,189
SS/JrHsdMcwi185,189


Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1564952Zranb3zinc finger RANBP2-type containing 3134466137544812430Rat

Nucleotide Sequences
GenBank Nucleotide JH617833 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
738036Lnnr4Liver neoplastic nodule remodeling QTL 43.64liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)13147622148Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)131107975663Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131107975663Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131107975663Rat
61339Bp24Blood pressure QTL 240.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)13901674250513953Rat
1581554Pur11Proteinuria QTL 11urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13901690682995569Rat
1581573Uae36Urinary albumin excretion QTL 36urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13901690682995569Rat
1581570Eae17Experimental allergic encephalomyelitis QTL 174.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)1312193394108478121Rat
9589141Insul28Insulin level QTL 2810.820.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)131409633059096330Rat
7411662Foco29Food consumption QTL 2920.80.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)131409633059096330Rat
1300163Cardf1Cardiac cell morphology QTL 14.18aorta morphology trait (VT:0000272)artery lesion measurement (CMO:0000975)131444158250799665Rat
2302275Gluco37Glucose level QTL 373.8blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)131444158251577031Rat
2317040Aia21Adjuvant induced arthritis QTL 212.75joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)131462463159624631Rat
2317046Aia8Adjuvant induced arthritis QTL 83.9700000286102295joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)131462463159624631Rat
631645Bp121Blood pressure QTL 1213.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131981081464810814Rat
9589164Gluco66Glucose level QTL 666.670.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)132005247765052477Rat
1331784Bp222Blood pressure QTL 2222.944arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)132148248158537177Rat
7207885Glom27Glomerulus QTL 273.9kidney glomerulus integrity trait (VT:0010546)kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)1324502279108770533Rat
61391Bp5Blood pressure QTL 55.6arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)132800833873008338Rat
70170Eae14Experimental allergic encephalomyelitis QTL 140.0024nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)132858445273584452Rat
1558644Cm45Cardiac mass QTL 453.60.002heart mass (VT:0007028)heart wet weight (CMO:0000069)132907693474076934Rat
6893338Cm76Cardiac mass QTL 7600.99heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)132907693474076934Rat
2303030Bp327Blood pressure QTL 327arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)133530126346444796Rat
1354621Rf47Renal function QTL 473.7kidney renin amount (VT:0010559)kidney renin level (CMO:0002166)1335301263107975663Rat
2301962Cm72Cardiac mass QTL 724.12heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)133614753364868393Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)133614753399968921Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133614753399968921Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)133614753399968921Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)133614753399968921Rat
2303563Bw89Body weight QTL 896body mass (VT:0001259)body weight (CMO:0000012)133734634882346348Rat
61340Bp25Blood pressure QTL 254.20.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133937292784372927Rat
10755495Bp387Blood pressure QTL 3873.78arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133950130093652524Rat
2292232Pur16Proteinuria QTL 1617.2total urine protein amount (VT:0000032)urine protein level (CMO:0000591)134106005747227923Rat
4889861Pur29Proteinuria QTL 2913.80.005total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)134231074486833540Rat
1331750Bp220Blood pressure QTL 2202.98arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)134231074487310744Rat
70220Bp55Blood pressure QTL 555.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)134250834587508345Rat
61349Bp31Blood pressure QTL 315.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)134250834587508345Rat
1549897Stresp12Stress response QTL 123.35stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)134357571788575717Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 304761 UniSTS
UniSTS 517972 UniSTS