D10Chm250 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D10Chm250

Symbol: D10Chm250
Previously known as:
RGD ID: 1579067
Expected Size: 218 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2750,146,501 - 50,146,536 (-)MAPPERmRatBN7.2
mRatBN7.21017,197,222 - 17,197,278 (-)MAPPERmRatBN7.2
mRatBN7.21095,968,533 - 95,968,747 (+)MAPPERmRatBN7.2
Rnor_6.01099,338,724 - 99,338,941NCBIRnor6.0
Rnor_5.01099,034,847 - 99,035,064UniSTSRnor5.0
RGSC_v3.410100,464,773 - 100,464,990UniSTSRGSC3.4
Celera1094,614,427 - 94,614,644UniSTS
Cytogenetic Map10 RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Epistasis, not numbers, regulates functions of clustered Dahl rat quantitative trait loci applicable to human hypertension. Charron S, etal., Hypertension. 2005 Dec;46(6):1300-8. Epub 2005 Nov 14.
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CGGATGTACCTCCCCAATAA
Reverse Primer AAAGGAGGAGGAGTGGATGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
71038Gdf9growth differentiation factor 9103758920037599970Rat
68424Dlg4discs large MAGUK scaffold protein 4105474070054769097Rat
3877Tnfaip1TNF alpha induced protein 1106341777463432466Rat
69435Tcam1testicular cell adhesion molecule 1109120847091220484Rat
69423Srebf1sterol regulatory element binding transcription factor 1104500763745029650Rat
68405Atp6v0a1ATPase H+ transporting V0 subunit a1108593580285989901Rat
68406Timm22translocase of inner mitochondrial membrane 22106125345961261217Rat
68408Lasp1LIM and SH3 protein 1108279517782835659Rat
68949Il13interleukin 13103779013037792687Rat
2054Adra1badrenoceptor alpha 1B102825502528373418Rat
2875Igfbp4insulin-like growth factor binding protein 4108399525384007272Rat
3702Slc22a5solute carrier family 22 member 5103800830338035474Rat
3636Scn4asodium voltage-gated channel alpha subunit 4109124693691296670Rat
3644Ccl11C-C motif chemokine ligand 11106702832867032929Rat
3645Ccl2C-C motif chemokine ligand 2106700542467007222Rat
61817Col1a1collagen type I alpha 1 chain107988362279900625Rat
3575Pdlim4PDZ and LIM domain 4103819868638212935Rat
3927Ubtfupstream binding transcription factor108725821787274291Rat
3942Unc119unc-119 lipid binding chaperone106323786263243339Rat
3949Vamp2vesicle-associated membrane protein 2105379358153797815Rat
3572Rgs9regulator of G-protein signaling 9109419526594270892Rat
3612Ncor1nuclear receptor co-repressor 1104699953647142294Rat
3647Ccl3C-C motif chemokine ligand 3106845138868452938Rat
68432Cldn7claudin 7105468968454692177Rat
2218Brca1BRCA1, DNA repair associated108641744186477762Rat
619980Hdac5histone deacetylase 5108715297887187921Rat
3967Vtnvitronectin106339473263397812Rat
3972Wnt3Wnt family member 3108868019888724170Rat
2541Efnb3ephrin B3105427450654281951Rat
71074Lhx1LIM homeobox 1106939682969403617Rat
3177Ngfrnerve growth factor receptor108051528780533518Rat
3192Npm1nucleophosmin 1101774151217751626Rat
71093Gosr1golgi SNAP receptor complex member 1106157049961607287Rat
71101Abcc3ATP binding cassette subfamily C member 3107929668179342749Rat
3297Pemtphosphatidylethanolamine N-methyltransferase104477591044849990Rat
3857Thrathyroid hormone receptor alpha108370188583729408Rat
68327Hap1huntingtin-associated protein 1108527789085286126Rat
619759Grb7growth factor receptor bound protein 7108344338783453057Rat
619773Epn2epsin 2104619778546259673Rat
619780Sez6seizure related 6 homolog106281893162868686Rat
61276Crhr1corticotropin releasing hormone receptor 1108904018689083481Rat
619947Mpripmyosin phosphatase Rho interacting protein104445394944573843Rat
69069Ccl5C-C motif chemokine ligand 5106832282668327380Rat
2161Asgr2asialoglycoprotein receptor 2105482140754834624Rat
2171Atp1b2ATPase Na+/K+ transporting subunit beta 2105431869854324933Rat
2175Atp2a3ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 3105758174257612758Rat
2088Aldh3a1aldehyde dehydrogenase 3 family, member A1104589299345902680Rat
3276Pctpphosphatidylcholine transfer protein107480888774856260Rat
2242Car4carbonic anhydrase 4106982794569836501Rat
3534Rararetinoic acid receptor, alpha108388349083928932Rat
61830Kcnab3potassium voltage-gated channel subfamily A regulatory beta subunit 3105404783054056401Rat
61855Gabra1gamma-aminobutyric acid type A receptor subunit alpha 1102659515126650611Rat
3322Phb1prohibitin 1108060526880618043Rat
619906Ddx5DEAD-box helicase 5109172350891732210Rat
3350Pld2phospholipase D2105525632655274192Rat
3359Pmp22peripheral myelin protein 22104779570947825715Rat
3361Pnmtphenylethanolamine-N-methyltransferase108338301983386557Rat
619913Tekt1tektin 1105695216456980572Rat
61966Gabrg2gamma-aminobutyric acid type A receptor subunit gamma 2102637469326463937Rat
61983Grngranulin precursor108738767287393777Rat
70928Kif1ckinesin family member 1C105541441255444587Rat
69311Slit3slit guidance ligand 3101957179820156634Rat
2415Cryba1crystallin, beta A1106260837362614726Rat
3986Rnf112ring finger protein 112104612114646126691Rat
71012Fzd2frizzled class receptor 2108756186687563776Rat
2644G6pc1glucose-6-phosphatase catalytic subunit 1108630740086318766Rat
2709Gipgastric inhibitory polypeptide108096836080976506Rat
2900Il5interleukin 5103787434237877213Rat
69329Maptmicrotubule-associated protein tau108913864489236137Rat
69331Git1GIT ArfGAP 1106234208262356379Rat
69224Gpx3glutathione peroxidase 3103902862439036695Rat
61866Aldh3a2aldehyde dehydrogenase 3 family, member A2104592831345949366Rat
61875Psmb3proteasome 20S subunit beta 3108269742582704521Rat
620067Scpep1serine carboxypeptidase 1107370327573732892Rat
2786Hcrthypocretin neuropeptide precursor108568997985691214Rat
70493Alox15arachidonate 15-lipoxygenase105506016955068885Rat
3779Stk10serine/threonine kinase 10101711786017212065Rat
70902Cntnap1contactin associated protein 1108610985086125612Rat
70906Aipl1aryl hydrocarbon receptor-interacting protein-like 1105665569356664922Rat
3742Sparcsecreted protein acidic and cysteine rich103951639439538252Rat
70367Vmp1vacuole membrane protein 1107140505871505045Rat
2349Chrnb1cholinergic receptor nicotinic beta 1 subunit105450109654516418Rat
2353Chrnecholinergic receptor nicotinic epsilon subunit105533121155339923Rat
619936Krt19keratin 19108507583585080552Rat
3385Ppypancreatic polypeptide108705474787056044Rat
3391Prkar1aprotein kinase cAMP-dependent type I regulatory subunit alpha109462104294639534Rat
3395Prkcaprotein kinase C, alpha109288939093288013Rat
2679Gfapglial fibrillary acidic protein108785289187861631Rat
2686Gh1growth hormone 1109122810291230079Rat
2230C1qbpcomplement C1q binding protein105569995455704605Rat
3889Tp53tumor protein p53105430007054311525Rat
2961Kcnmb1potassium calcium-activated channel subfamily M regulatory beta subunit 1101855751018614824Rat
2650Gabrb2gamma-aminobutyric acid type A receptor subunit beta 2102693659227156141Rat
2662Gastgastrin108526483285269393Rat
2160Asgr1asialoglycoprotein receptor 1105477572754779642Rat
620014Mpp2MAGUK p55 scaffold protein 2108701143487043883Rat
3139Myh4myosin heavy chain 4105192314951946297Rat
2018AclyATP citrate lyase108541204585464253Rat
70993Flot2flotillin 2106292604762947759Rat
62048Top2aDNA topoisomerase II alpha108394573183976874Rat
62062Mybbp1aMYB binding protein 1a105705689757067258Rat
62067Rpl23ribosomal protein L23108277187882775840Rat
71048Ap2b1adaptor related protein complex 2 subunit beta 1106809939768205023Rat
3714Slc6a4solute carrier family 6 member 4106182420861858924Rat
69428Pdk2pyruvate dehydrogenase kinase 2107997255079987074Rat
3671Shbgsex hormone binding globulin105433293954350409Rat
3240P2rx1purinergic receptor P2X 1105761858657633648Rat
69403Acsl6acyl-CoA synthetase long-chain family member 6103843991438501182Rat
69405Zfp354czinc finger protein 354C103512972035145717Rat
69409Galnt10polypeptide N-acetylgalactosaminyltransferase 10104182121641967618Rat
3185Nos2nitric oxide synthase 2106381530863851208Rat
3710Slc4a1solute carrier family 4 member 1 (Diego blood group)108730686587323132Rat
61927Pecam1platelet and endothelial cell adhesion molecule 1109159052191652279Rat
621456Pnpopyridoxamine 5'-phosphate oxidase108192458481930844Rat
620304Kcnh6potassium voltage-gated channel subfamily H member 6109094924090970746Rat
628809Alox15barachidonate 15-lipoxygenase, type B105389249653901812Rat
708439Srcin1SRC kinase signaling inhibitor 1108250291182569882Rat
631328Tbkbp1TBK1 binding protein 1108212055882135749Rat
2364Cltcclathrin heavy chain107151766171574591Rat
68359Pttg1PTTG1 regulator of sister chromatid separation, securin102789346627904965Rat
620683Rps6kb1ribosomal protein S6 kinase B1107132377771367908Rat
620684Synrgsynergin, gamma106884882868931252Rat
620685Aatfapoptosis antagonizing transcription factor106929902969392207Rat
621505Mapk7mitogen-activated protein kinase 7104617026446176262Rat
621693Aspaaspartoacylase105789170457945267Rat
621235Ndel1nudE neurodevelopment protein 1-like 1105350562853582025Rat
619957Wfdc18WAP four-disulfide core domain 18106858881868590972Rat
620666Map2k6mitogen-activated protein kinase kinase 6109537330495490406Rat
620412Jupjunction plakoglobin108530043885327378Rat
621859Ppp1r1bprotein phosphatase 1, regulatory (inhibitor) subunit 1B108334773183356775Rat
2393Cpdcarboxypeptidase D106162352861687491Rat
2897Il3interleukin 3103840571638408066Rat
2898Il4interleukin 4103777120337776750Rat
2909Kpnb1karyopherin subunit beta 1108214566282174437Rat
628661Abca5ATP binding cassette subfamily A member 5109524015995309195Rat
2704Glra1glycine receptor, alpha 1103962585339727897Rat
628827Nr1d1nuclear receptor subfamily 1, group D, member 1108372834883735562Rat
619962Npeppsaminopeptidase puromycin sensitive108219145482273967Rat
621536Kif3akinesin family member 3a103772593037761183Rat
628842Tac4tachykinin precursor 4108020782480216156Rat
619765Xylt2xylosyltransferase 2107960591079619482Rat
628841Trpv1transient receptor potential cation channel, subfamily V, member 1105785142857876513Rat
620392Ube2g1ubiquitin-conjugating enzyme E2G 1105722596357306748Rat
621710Pip4k2bphosphatidylinositol-5-phosphate 4-kinase type 2 beta108270601682734938Rat
708470Ifi47interferon gamma inducible protein 47103329761833305248Rat
621271Arf2ADP-ribosylation factor 2108886783688889654Rat
628766Casc3CASC3 exon junction complex subunit108376901483788966Rat
631335Obscnobscurin, cytoskeletal calmodulin and titin-interacting RhoGEF104377411343919718Rat
621415Kcnh4potassium voltage-gated channel subfamily H member 4108566833285688166Rat
620757Pex12peroxisomal biogenesis factor 12106809577668103812Rat
2336Chadchondroadherin107951217079515941Rat
727863Per1period circadian regulator 1105380012653814963Rat
621321Myo1dmyosin ID106548915365765812Rat
70886Kcnip1potassium voltage-gated channel interacting protein 1101821951918588833Rat
619743Lcp2lymphocyte cytosolic protein 2101864260018689562Rat
620207Prpsap2phosphoribosyl pyrophosphate synthetase-associated protein 2104641081746445929Rat
727783Slc35b1solute carrier family 35, member B1108032792180335279Rat
620152Spag5sperm associated antigen 5106319871763216746Rat
621126Tob1transducer of ErbB-2.1107916309379165131Rat
69290Trim17tripartite motif-containing 17104374311143750929Rat
620656Fat2FAT atypical cadherin 2103936407239456324Rat
708560Coro6coronin 6106231155262319659Rat
3004Lgals5galectin 5106385394963857198Rat
628704Il12binterleukin 12B102888883228903802Rat
620441Ccl4C-C motif chemokine ligand 4106846639468468229Rat
628785Krt9keratin 9108512096285127228Rat
727941Aoc2-ps1amine oxidase, copper containing 2, pseudogene 1108626700786268473Rat
621155Nmur2neuromedin U receptor 2104016622340182078Rat
620256P2rx5purinergic receptor P2X 5105777773757789426Rat
3005Lgals9galectin 9106390701863930224Rat
3012Llgl1LLGL scribble cell polarity complex component 1104537942345394096Rat
2426Csf3colony stimulating factor 3108366078783664569Rat
621419Kpna2karyopherin subunit alpha 2109193395191946115Rat
61917Stx8syntaxin 8105265564352900048Rat
69229Rack1receptor for activated C kinase 1103316941533174896Rat
620012Cd79bCD79b molecule109123935491242500Rat
708345Ube2bubiquitin-conjugating enzyme E2B103624843436263379Rat
620455Slfn4schlafen family member 4106799460168018141Rat
708487Adap2ArfGAP with dual PH domains 2106513800665166147Rat
61933Atp5mc1ATP synthase membrane subunit c locus 1108102405681026780Rat
621722Fbxl20F-box and leucine-rich repeat protein 20108308056883143680Rat
727875G6pc3glucose 6 phosphatase catalytic subunit 3108714698787151223Rat
68360Dbil5diazepam binding inhibitor-like 5106107353861074550Rat
621644Itgaeintegrin subunit alpha E105770481357764093Rat
620097Mgat1alpha-1,3-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase103356364233582718Rat
621594NsfN-ethylmaleimide sensitive factor, vesicle fusing ATPase108872791288857375Rat
621660Kcnj12potassium inwardly-rectifying channel, subfamily J, member 12104569662145745528Rat
620767P3h4prolyl 3-hydroxylase family member 4108533815885345108Rat
735025Or2y13olfactory receptor family 2 subfamily Y member 13103378883233789767Rat
735028Ppm1eprotein phosphatase, Mg2+/Mn2+ dependent, 1E107205164372187439Rat
69259Axin2axin 2109389383093927042Rat
620693Nxph3neurexophilin 3108045628380459949Rat
620532Gabrpgamma-aminobutyric acid type A receptor subunit pi101814303118169595Rat
620519Doc2bdouble C2 domain beta106062802960653267Rat
62077SeboxSEBOX homeobox106339921563400086Rat
62079Gosr2golgi SNAP receptor complex member 2108858529188605642Rat
2920Irf1interferon regulatory factor 1103791715537924166Rat
619874Cdkl3cyclin-dependent kinase-like 3103626321236349268Rat
619877Nme2NME/NM23 nucleoside diphosphate kinase 2107889809778903514Rat
621111Cdk12cyclin-dependent kinase 12108320117783256906Rat
708476Slc25a11solute carrier family 25 member 11105535759055360441Rat
1304913Mrpl45mitochondrial ribosomal protein L45108230865082320474Rat
621737Flt4Fms related receptor tyrosine kinase 4103391372533954770Rat
621743Ddx52DExD-box helicase 52106882459468847400Rat
621541Or2z2olfactory receptor family 2 subfamily Z member 2104263822742639174Rat
708563Tspoap1TSPO associated protein 1107255422072586402Rat
628804Cacng4calcium voltage-gated channel auxiliary subunit gamma 4109268377892745842Rat
628805Cacng5calcium voltage-gated channel auxiliary subunit gamma 5109282744192869632Rat
621625Aurkbaurora kinase B105374429053750831Rat
621118Nlgn2neuroligin 2105454446154557854Rat
621149Slc22a4solute carrier family 22 member 4103813333338179932Rat
621158Clec10aC-type lectin domain containing 10A105487624454880439Rat
621172Anxa6annexin A6103910139539156483Rat
621183Rpl19ribosomal protein L19108302250383026030Rat
621192Rpl27ribosomal protein L27108637551186379210Rat
621204Rpl37l1ribosomal protein L37-like 1106103379961034157Rat
621206Hand1heart and neural crest derivatives expressed 1104200664642009213Rat
628868Itgb3integrin subunit beta 3108950991789564679Rat
628878Hspa4heat shock protein family A (Hsp70) member 4103740802537449080Rat
628882Elac2elaC ribonuclease Z 2104963230849655614Rat
628889Gjc1gap junction protein, gamma 1108775819287785443Rat
620492Slc36a2solute carrier family 36 member 2103927800239306082Rat
621684Atox1antioxidant 1 copper chaperone103956485539579892Rat
727962Pigwphosphatidylinositol glycan anchor biosynthesis, class W106974699669782656Rat
727966Kat7lysine acetyltransferase 7108022151980255590Rat
628847Mapk9mitogen-activated protein kinase 9103416966134211138Rat
621065Csf2colony stimulating factor 2103838694538388926Rat
620437Piglphosphatidylinositol glycan anchor biosynthesis, class L104714216047199892Rat
68382Cacnb1calcium voltage-gated channel auxiliary subunit beta 1108299818283018838Rat
620270Glp2rglucagon-like peptide 2 receptor105240274852466012Rat
620953Ebf1EBF transcription factor 1102909585829489142Rat
619801Slc36a1solute carrier family 36 member 1103931906239357374Rat
619809Ntn1netrin 1105289993353098591Rat
3166Neurod2neuronal differentiation 2108332380183327986Rat
3168Nf1neurofibromin 1106430602764539112Rat
620438Gucy2dguanylate cyclase 2D, retinal105395491853975576Rat
620443Myo1cmyosin 1C106049837260520752Rat
727901Scgb3a1secretoglobin, family 3A, member 1103396805933969366Rat
727907Tenm2teneurin transmembrane protein 2102048066221706415Rat
628759Prop1PROP paired-like homeobox 1103527195935274434Rat
1304668Blmhbleomycin hydrolase106177211261815212Rat
2561Erbb2erb-b2 receptor tyrosine kinase 2108341119783435078Rat
621270Arf1ADP-ribosylation factor 1104399798344014461Rat
620015Mpp3MAGUK p55 scaffold protein 3108694570586975261Rat
2967Zfp354azinc finger protein 354A103539624235408069Rat
620677Ltc4sleukotriene C4 synthase103456047634562790Rat
62031Coilcoilin107378907773810378Rat
1303226Dnajc7DnaJ heat shock protein family (Hsp40) member C7108551863785555079Rat
621531Gria1glutamate ionotropic receptor AMPA type subunit 1104121071341527283Rat
620488Milr1mast cell immunoglobulin-like receptor 1109168428891705284Rat
621885Psmc3ipPSMC3 interacting protein108602428186027928Rat
632281Ppp1r9bprotein phosphatase 1, regulatory subunit 9B107993805579954085Rat
1303147Wfdc21WAP four-disulfide core domain 21106862783668633705Rat
2368Cnp2',3'-cyclic nucleotide 3' phosphodiesterase108551116485517723Rat
69358Sostsclerostin108691251786915561Rat
1304921Cdc27cell division cycle 27108940072089449816Rat
1304926Pfasphosphoribosylformylglycinamidine synthase105369030153711811Rat
631374Slc13a5solute carrier family 13 member 5105686624956891189Rat
62000Ywhaetyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon106058466560622352Rat
621140G3bp1G3BP stress granule assembly factor 1103958686439620268Rat
2017Asic2acid sensing ion channel subunit 2106587059266940577Rat
2249Cacng1calcium voltage-gated channel auxiliary subunit gamma 1109265292492665612Rat
2295Ccng1cyclin G1102517623125182604Rat
1307049Helzhelicase with zinc finger109247940392645234Rat
735046Prp2l1proline rich protein 2-like 1108846226288540642Rat
69195Nbr1NBR1, autophagy cargo receptor108647777586506418Rat
1303032Krt39keratin 39108447394684480552Rat
727898Col23a1collagen type XXIII alpha 1 chain103554909035839152Rat
621562Ubbubiquitin B104724763047249335Rat
620182Nup88nucleoporin 88105566790355692249Rat
621517Crlf3cytokine receptor-like factor 3106502422865060746Rat
1304829Med13mediator complex subunit 13107108697871176535Rat
1304854Plekhh3pleckstrin homology, MyTH4 and FERM domain containing H3108609846186106931Rat
1304861Cuedc1CUE domain containing 1107289263772986546Rat
1304870Elob-ps4elongin B, pseduogene 4107374986973750223Rat
2747Grm6glutamate metabotropic receptor 6103516798535182717Rat
61881Psmb6proteasome 20S subunit beta 6105523925655241586Rat
3970Foxn1forkhead box N1106325140063273710Rat
628642Nmt1N-myristoyltransferase 1108798882688025405Rat
628646Krt20keratin 20108438479084394125Rat
1303181Krt17keratin 17108517867385183392Rat
1305687Rnasekribonuclease K105495490454956622Rat
621542Rad50RAD50 double strand break repair protein103780935337861309Rat
621550Gas7growth arrest specific 7105215271852383283Rat
727812Rtn4rl1reticulon 4 receptor-like 1106004324660116977Rat
735057Rundc3aRUN domain containing 3A108735262487361767Rat
1304875Dlx3distal-less homeobox 3108006448980069891Rat
631432Slu7SLU7 homolog, splicing factor102790832527923784Rat
708436Skap1src kinase associated phosphoprotein 1108142547281732651Rat
2836Hsd17b1hydroxysteroid (17-beta) dehydrogenase 1108600972886011928Rat
2805Hmmrhyaluronan-mediated motility receptor102513293325163029Rat
708376Psmc5proteasome 26S subunit, ATPase 5109118776391193697Rat
619727Rasd1ras related dexamethasone induced 1104476645144775773Rat
3965Trpv2transient receptor potential cation channel, subfamily V, member 2104726552447294263Rat
629472Cdk5r1cyclin-dependent kinase 5 regulatory subunit 1106548426665485467Rat
735061Myh1myosin heavy chain 1105188591351909699Rat
1302969Phf23PHD finger protein 23105471866354722784Rat
1302978Ggnbp2gametogenetin binding protein 2106971152769743134Rat
1303200Ccl6C-C motif chemokine ligand 6106838018568385859Rat
2050Adora2badenosine A2B receptor104694039446956772Rat
2091Aldocaldolase, fructose-bisphosphate C106321747763221066Rat
69287Sqstm1sequestosome 1103452551734536670Rat
3774Stat5bsignal transducer and activator of transcription 5B108570484185775856Rat
1302937Krt13keratin 13108505188785056099Rat
2493Aceangiotensin I converting enzyme109091031690930437Rat
1303335Ggt6gamma-glutamyl transferase 6105705197757054900Rat
2555Eno3enolase 3105537053155375921Rat
631369Serpinf1serpin family F member 1106025019860262593Rat
69289Smarcd2SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2109119375291202817Rat
1304590Rap1gap2RAP1 GTPase activating protein 2105925540059472536Rat
1304598Abhd15abhydrolase domain containing 15106236320962368600Rat
1304909Ddx42DEAD-box helicase 42109114892691180940Rat
620342Rph3alrabphilin 3A-like (without C2 domains)106068994360833354Rat
620354Myh2myosin heavy chain 2105185673851883236Rat
620356Myh8myosin heavy chain 8105196351051993103Rat
620840Hnrnph1heterogeneous nuclear ribonucleoprotein H1103469286834702849Rat
1304611Zfp496zinc finger protein 496104426892344287795Rat
621799Dnah9dynein, axonemal, heavy chain 9105049617450864909Rat
62023Camkk1calcium/calmodulin-dependent protein kinase kinase 1105763733557660498Rat
621248Acacaacetyl-CoA carboxylase alpha106901426169276453Rat
1306819Ptrh2peptidyl-tRNA hydrolase 2107150511371515297Rat
1303303Elp5elongator acetyltransferase complex subunit 5105469252654704255Rat
735202Arhgap27Rho GTPase activating protein 27108828047088313225Rat
1304897Rpl23aribosomal protein L23A106307666063079346Rat
621825Pfn1profilin 1105536526355367968Rat
620826Akap1A-kinase anchoring protein 1107362102173654123Rat
628651Gm2aganglioside GM2 activator103921922139231756Rat
3137Myh13myosin heavy chain 13105201277952068960Rat
71000Myh10myosin heavy chain 10105339390153525174Rat
620190Becn1beclin 1108623138786246742Rat
621437H2ac25H2A clustered histone 25104373370243735254Rat
631401Wnk4WNK lysine deficient protein kinase 4108620255286219655Rat
1304726Smarce1SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1108415927084180547Rat
13047284933427D14RiklRIKEN cDNA 4933427D14 gene like105678386956832668Rat
1304575Map3k3mitogen activated protein kinase kinase kinase 3109102017491088852Rat
735087Spata20spermatogenesis associated 20107942752579435472Rat
735088Flcnfolliculin104458862144607808Rat
735094Srrserine racemase105976956359786688Rat
1304587C10h1orf35similar to human chromosome 1 open reading frame 35104399380943997287Rat
3138Myh3myosin heavy chain 3105177017751793994Rat
2711Slc2a4solute carrier family 2 member 4105466601554671581Rat
2405CrkCRK proto-oncogene, adaptor protein106053046960556703Rat
628606Tubg1tubulin, gamma 1108605284586059436Rat
1303328Clint1clathrin interactor 1103029861830353185Rat
1303311Lrrc46leucine rich repeat containing 46108202131482033575Rat
1303322Krt26keratin 26108428096584295575Rat
3683Lypd8l1LY6/PLAUR domain containing 8 like 1104261555542623925Rat
61872Ramp2receptor activity modifying protein 2108618736686190692Rat
735117Slc16a6solute carrier family 16, member 6109442437794447482Rat
1304846Amz2archaelysin family metallopeptidase 2109440154694412116Rat
1307463Krt14keratin 14108513778685142054Rat
62058Aoc3amine oxidase, copper containing 3108627275786280702Rat
2608Fgf18fibroblast growth factor 18101770601117737702Rat
621575Vdac1voltage-dependent anion channel 1103653230636559642Rat
1307415Dusp14dual specificity phosphatase 14106893648368966347Rat
1307421Foxi1forkhead box I1101880629218810231Rat
1307239Dhx33DEAH-box helicase 33105570810255724618Rat
708455Taok1TAO kinase 1106237307262465295Rat
1305204Rnf43ring finger protein 43107246150872537301Rat
1306416Epn3epsin 3107943897879449516Rat
1306708Traf4Tnf receptor associated factor 4106305416963060284Rat
1307515Adam11ADAM metallopeptidase domain 11108772411587742773Rat
1307520Hist3h2bahistone cluster 3, H2ba104372583643726465Rat
1307527Hic1HIC ZBTB transcriptional repressor 1106001452060019475Rat
727905StradaSTE20 related adaptor alpha109109484991123890Rat
3773Stat5asignal transducer and activator of transcription 5A108578553785809869Rat
1305112Tex2testis expressed 2109143662991546240Rat
1305547Ints2integrator complex subunit 2107103164771079138Rat
1305548Stac2SH3 and cysteine rich domain 2108303241883048260Rat
2266Canxcalnexin103462386534656866Rat
1305914Hes7hes family bHLH transcription factor 7105382412453828934Rat
1304714Eral1Era-like 12S mitochondrial rRNA chaperone 1106296172562968747Rat
1305128Polg2DNA polymerase gamma 2, accessory subunit109171258691723008Rat
1305130Zfp18zinc finger protein 18105047342850495707Rat
1305258Cwc25CWC25 spliceosome-associated protein homolog108273569882760373Rat
1307493Tlcd3aTLC domain containing 3A106105747061065293Rat
1307496Plxdc1plexin domain containing 1108292249982982124Rat
1305590Sar1bsecretion associated, Ras related GTPase 1B103602441536054069Rat
1307011Fxr2FMR1 autosomal homolog 2105435057754370964Rat
1305437Tex14testis expressed 14, intercellular bridge forming factor107223176672356938Rat
1305651Ccnqcyclin Q106364653263647695Rat
1306364Fam20aFAM20A, golgi associated secretory pathway pseudokinase109463883694697814Rat
1306372Supt4h1SPT4 homolog, DSIF elongation factor subunit107253932372545582Rat
1307363Nkiras2NFKB inhibitor interacting Ras-like 2108555470485562072Rat
1305092Lrrc59leucine rich repeat containing 59107957229579586953Rat
1305097Pcgf2polycomb group ring finger 2108268256382694563Rat
1305099Rufy1RUN and FYVE domain containing 1103470574134750644Rat
1305819Slc43a2solute carrier family 43 member 2106037546260420838Rat
1306039C1ql1complement C1q like 1108790212587909556Rat
620331Pafah1b1platelet-activating factor acetylhydrolase 1b, regulatory subunit 1105953304259591808Rat
1303097Gfpt2glutamine-fructose-6-phosphate transaminase 2103411500534161329Rat
69255Hnrnpabheterogeneous nuclear ribonucleoprotein A/B103585704035862935Rat
1306740Zfp692zinc finger protein 692104248457642496573Rat
61911GabarapGABA type A receptor-associated protein105471477754718099Rat
1305018Wnt9aWnt family member 9A104409414044121134Rat
1307319Snx11sorting nexin 11108174202081752778Rat
1307326Hs3st3b1heparan sulfate-glucosamine 3-sulfotransferase 3B1104856147348593970Rat
1307328Trim7tripartite motif-containing 7103320549133221482Rat
1307504Krtap3-3keratin associated protein 3-3108451145984511758Rat
1306989Dhrs7cdehydrogenase/reductase 7C105249526252513338Rat
1306996Psme3proteasome activator subunit 3108625767286265458Rat
1306401Cnot8CCR4-NOT transcription complex, subunit 8104228161442294740Rat
1306279AbrABR activator of RhoGEF and GTPase106126251661461331Rat
1305473Spag7sperm associated antigen 7105537724955383404Rat
1306896Igtpinterferon gamma induced GTPase104237459042382410Rat
1306897Nek8NIMA-related kinase 8106306086863073546Rat
1305068Ybx2Y box binding protein 2105465971954665371Rat
1306320Pelp1proline, glutamate and leucine rich protein 1105509479855111833Rat
1305048Cyfip2cytoplasmic FMR1 interacting protein 2103062131830741113Rat
1305140Dcaf7DDB1 and CUL4 associated factor 7109097409590996275Rat
1307069Abca8ATP binding cassette subfamily A member 8109491752094991199Rat
1307966Fam171a2family with sequence similarity 171, member A2108739388887404051Rat
1307981Luc7l3LUC7-like 3 pre-mRNA splicing factor107924005079276555Rat
1307590FliiFLII, actin remodeling protein104539403245408051Rat
1307242Kat2alysine acetyltransferase 2A108563221685640561Rat
1305058Rab34RAB34, member RAS oncogene family106308331963087538Rat
1305063Rab11fip4RAB11 family interacting protein 4106455010964658123Rat
2014Acadvlacyl-CoA dehydrogenase, very long chain105473287554738102Rat
1307444Tmigd1transmembrane and immunoglobulin domain containing 1106173907161751025Rat
708580Igf2bp1insulin-like growth factor 2 mRNA binding protein 1108090830080951097Rat
1306450Psmd11proteasome 26S subunit, non-ATPase 11106543385365479774Rat
1307685Cavin1caveolae associated protein 1108588410085896136Rat
1307691RilpRab interacting lysosomal protein106035527660358434Rat
13085644930438A08RiklRIKEN cDNA 4930438A08 gene like104245994842477215Rat
1307010Glod4glyoxalase domain containing 4106107753561095876Rat
1307333Abca8aATP-binding cassette, subfamily A (ABC1), member 8a109500233495072315Rat
1306656Inca1inhibitor of CDK, cyclin A1 interacting protein 1105540198955414364Rat
1306657Usp32ubiquitin specific peptidase 32106985589570029075Rat
1306728Tom1l2target of myb1 like 2 membrane trafficking protein104503603445158168Rat
1307016Plscr3phospholipid scramblase 3105456655654573240Rat
1307022Poldip2DNA polymerase delta interacting protein 2106340723763417605Rat
1307023Rhot1ras homolog family member T1106519870065262807Rat
1307024Ikzf3IKAROS family zinc finger 3108346056483553591Rat
1306530Krt34keratin 34108496998884974098Rat
1305163Irgmimmunity-related GTPase M103323351333241594Rat
1304553Ifi35interferon-induced protein 35108638102386389279Rat
735141Eif4a1eukaryotic translation initiation factor 4A1105438434554389855Rat
735151Ccr7C-C motif chemokine receptor 7108409819384108309Rat
1307376Rpa1replication protein A1106014886960199970Rat
1307720Socs7suppressor of cytokine signaling 7108235215982388829Rat
1307767Mfsd6lmajor facilitator superfamily domain containing 6-like105325879453260887Rat
1310607Rpl26ribosomal protein L26105361083653613966Rat
3772Stat3signal transducer and activator of transcription 3108581120685863057Rat
3830Hnf1bHNF1 homeobox B106873589468789888Rat
619860Dynll2dynein light chain LC8-type 2107276703572785824Rat
1305931Abca9ATP binding cassette subfamily A member 9109507761595137751Rat
1307369Smyd4SET and MYND domain containing 4106020006760246387Rat
1307423Tmem97transmembrane protein 97106343822863447311Rat
1305894Tcf7transcription factor 7103642344336454350Rat
1305028Ezh1enhancer of zeste 1 polycomb repressive complex 2 subunit108612602386162001Rat
1306638Sgcdsarcoglycan, delta103134648032328364Rat
1307488Cntrobcentrobin, centriole duplication and spindle assembly protein105402252354047793Rat
1307490Rundc1RUN domain containing 1108636163586375446Rat
1306689Mllt6MLLT6, PHD finger containing108265725882678899Rat
1306692Serpinf2serpin family F member 2106027240060280506Rat
1305360Acap1ArfGAP with coiled-coil, ankyrin repeat and PH domains 1105460532354619472Rat
1305361Wfikkn2WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2107918556379191657Rat
1307740Natd1N-acetyltransferase domain containing 1104558015445590333Rat
1307741Scrn2secernin 2108201660482020676Rat
620162Fgf11fibroblast growth factor 11105451650854522067Rat
1305385Hrobhomologous recombination factor with OB-fold108720601787222483Rat
1305161Atpaf2ATP synthase mitochondrial F1 complex assembly factor 2104520565845221891Rat
1304758Tmub2transmembrane and ubiquitin-like domain containing 2108723854387242968Rat
1306595Tefmtranscription elongation factor, mitochondrial106511965765124233Rat
1307203Nudcd2NudC domain containing 2102516324725168738Rat
3183Nognoggin107412871274130339Rat
1307039Bptfbromodomain PHD finger transcription factor109198027992082731Rat
1307040Map2k4mitogen activated protein kinase kinase 4105034322750447956Rat
1306768Sp6Sp6 transcription factor108200551882009699Rat
1306784Taco1translational activator of cytochrome c oxidase I109100259091010494Rat
1305252Rnf135ring finger protein 135106517056065189791Rat
1305871Tnfsf13TNF superfamily member 13105440005454403723Rat
61920Slc13a2solute carrier family 13 member 2106329181363319127Rat
70497Nme1NME/NM23 nucleoside diphosphate kinase 1107890703678929659Rat
1305731Phf12PHD finger protein 12106287130962919026Rat
1305423Efcab3EF-hand calcium binding domain 3108958352690077260Rat
1306000Iba57iron-sulfur cluster assembly factor IBA57104394201743950807Rat
1305362Fam114a2family with sequence similarity 114, member A2104166178741696790Rat
1307186Jmjd4jumonji domain containing 4104423446544242754Rat
1303290Klhl10kelch-like family member 10108537644285392720Rat
1304805Krt12keratin 12108437080384378103Rat
708425Havcr1hepatitis A virus cellular receptor 1103111866731151730Rat
620258Rcvrnrecoverin105238870652396454Rat
68942Cacna1gcalcium voltage-gated channel subunit alpha1 G107935499879422960Rat
1307754Wipi1WD repeat domain, phosphoinositide interacting 1109454294694580174Rat
1305522B9d1B9 domain containing 1104618622246196309Rat
1307125Kctd11potassium channel tetramerization domain containing 11105460257554604738Rat
1307222Cluhclustered mitochondria homolog105950958059531345Rat
1307227Fstl4follistatin-like 4103691142237344545Rat
1306308Eif1eukaryotic translation initiation factor 1108524675185248842Rat
1333911Or2ak5olfactory receptor family 2 subfamily AK member 5104335448643355406Rat
1332774Or2ak6bolfactory receptor family 2 subfamily AK member 6B104337354643374466Rat
1332779Or1ad1b-ps1olfactory receptor family 1 subfamily AD member 1B, pseudogene 1103527869635279251Rat
1311493Atxn7l3ataxin 7-like 3108724284387250186Rat
1333938Or2ak6eolfactory receptor family 2 subfamily AK member 6E104307288443073804Rat
1308631Maml1mastermind-like transcriptional coactivator 1103458863934623024Rat
1308636Rnf187ring finger protein 187104370949343715392Rat
1309277Mrpl22mitochondrial ribosomal protein L22104234544642355779Rat
1305330Alox12barachidonate 12-lipoxygenase, 12R type105386306053874938Rat
1309441Lsm12LSM12 homolog108711833487140395Rat
1333284Or2y17-ps1olfactory receptor family 2 subfamily Y member 17, pseudogene 1103363807633639211Rat
1308329Wwc1WW and C2 domain containing 1102030073520454393Rat
1310172Ctdnep1CTD nuclear envelope phosphatase 1105470436754713781Rat
1308683MntMAX network transcriptional repressor105969920859714848Rat
1333640Or2t48bolfactory receptor family 2 subfamily T member 48B104275874542759674Rat
1333644Or1e23olfactory receptor family 1 subfamily E member 23105830532158315807Rat
1333651Or2t46-ps1olfactory receptor family 2 subfamily T member 46, pseudogene 1104282201942823149Rat
1333402Or2y1golfactory receptor family 2 subfamily Y member 1G103359878833599723Rat
1309906AdprmADP-ribose/CDP-alcohol diphosphatase, manganese-dependent105173207351744635Rat
1333419Or2y15olfactory receptor family 2 subfamily Y member 15103370729133708226Rat
1333422Or2t48olfactory receptor family 2 subfamily T member 48104278677542787719Rat
1311042Fmnl1formin-like 1108811587688143342Rat
1308404Acbd4acyl-CoA binding domain containing 4108804805888062612Rat
1309090Mrpl27mitochondrial ribosomal protein L27107959545979601242Rat
1311987Pld6phospholipase D family, member 6104457853644581187Rat
1333495Or2w26-ps1olfactory receptor family 2 subfamily W member 26, pseudogene 1104334022243341116Rat
1333892Or3a1olfactory receptor family 3 subfamily A member 1105914707559148022Rat
1308942Gjd3gap junction protein, delta 3108393369483935759Rat
1308943Vat1vesicle amine transport 1108638954986397167Rat
1307274Sdf2stromal cell derived factor 2106314056363151038Rat
1307288Prr29proline rich 29109130582091320661Rat
1309742Arhgap23Rho GTPase activating protein 23108243757882496846Rat
1309749Trim16tripartite motif-containing 16104748598247509010Rat
1560562Sppl2csignal peptide peptidase like 2C108909527989097487Rat
1332930Olr1520olfactory receptor 1520105923700359237938Rat
1309718Specc1sperm antigen with calponin homology and coiled-coil domains 1104663894746912989Rat
1310402Tns4tensin 4108402196584041346Rat
1308645Slfn2schlafen family member 2106795332267959659Rat
1332835Or2ak4olfactory receptor family 2 subfamily AK member 4104311703943117959Rat
1332843Or1x2olfactory receptor family 1 subfamily X member 2103535277635353717Rat
1332844Or1e28olfactory receptor family 1 subfamily E member 28105846875258469690Rat
1332668Olr1489-psolfactory receptor pseudogene 1489105842187558422035Rat
1309650Efcab5EF-hand calcium binding domain 5106192641962042745Rat
1333378Or1e19b-ps1olfactory receptor family 1 subfamily E member 19, pseudogene 1105819600958196513Rat
1560459Gltpd2glycolipid transfer protein domain containing 2105523356355236125Rat
1333517Or1e27olfactory receptor family 1 subfamily E member 27105840634458407282Rat
1308105Ksr1kinase suppressor of ras 1106396177164098076Rat
1308025Slc35g3solute carrier family 35, member G3105447879654481543Rat
1308029Eif5aeukaryotic translation initiation factor 5A105464010454644845Rat
1309576Tmem220transmembrane protein 220105171977751728792Rat
1333146Or3a1folfactory receptor family 3 subfamily A member 1F105900005359001000Rat
1333061Or2t47eolfactory receptor family 2 subfamily T member 47E104284249242843454Rat
1333064Olr1523olfactory receptor 1523107270827272709213Rat
1333296Or1e18b-ps1olfactory receptor family 1 subfamily E member 18, pseudogene 1105828917358290117Rat
1559818Tp53i13tumor protein p53 inducible protein 13106235672262363122Rat
1359195Tlcd1TLC domain containing 1106307446963076502Rat
1309585Sap30lSAP30-like104197973041992307Rat
1310360Kif18bkinesin family member 18B108787042487889895Rat
1309141Osbpl7oxysterol binding protein-like 7108203599582053566Rat
1309150Drc3dynein regulatory complex subunit 3104514909445200659Rat
1309152Jade2jade family PHD finger 2103607523936124210Rat
1333898Or2ak5eolfactory receptor family 2 subfamily AK member 5E104308986543090782Rat
1333927Olr1400olfactory receptor 1400103381634533817280Rat
1333085Or9e1bolfactory receptor family 9 subfamily E member 1B104359542243596348Rat
1333088Or1e26bolfactory receptor family 1 subfamily E member 26B105834934858350286Rat
1311929Ccdc43coiled-coil domain containing 43108765055487662788Rat
1359411Krt31keratin 31108497939384982898Rat
1334164Or11l3olfactory receptor family 11 subfamily L member 3104300763343008604Rat
1334167Or2ak5bolfactory receptor family 2 subfamily AK member 5B104331019843311118Rat
1309875Lig3DNA ligase 3106771780867741141Rat
1333178Or1e35bolfactory receptor family 1 subfamily E member 35B105879721258798150Rat
1332670Or2t47olfactory receptor family 2 subfamily T member 47104291754542918492Rat
1333585Or1e33olfactory receptor family 1 subfamily E member 33105861421758615152Rat
1333590Or1e16dolfactory receptor family 1 subfamily E member 16D105803624258037186Rat
1334004Olr1477-psolfactory receptor pseudogene 1477105836833958369460Rat
1332943Or2ak5folfactory receptor family 2 subfamily AK member 5F104326904643269960Rat
1332945Or2ak5dolfactory receptor family 2 subfamily AK member 5D104321257143213491Rat
1332948Or5af1olfactory receptor family 5 subfamily AF member 1104354744743548373Rat
1334234Olr1444-psolfactory receptor pseudogene 1444104329436443294561Rat
1334237Or3a1eolfactory receptor family 3 subfamily A member 1E105902335359024300Rat
1333952Olr1481olfactory receptor 1481105823788658238830Rat
1332685Or1a1olfactory receptor family 1 subfamily A member 1105905894159059879Rat
1332688Or2t29olfactory receptor family 2 subfamily T member 29104290725942908197Rat
1308314Nlrp3NLR family, pyrin domain containing 3104432677044353814Rat
1311549Rasgef1cRasGEF domain family, member 1C103422748334293676Rat
2157Arrb2arrestin, beta 2105514688755154854Rat
1312011Shmt1serine hydroxymethyltransferase 1104546869845490833Rat
1308349Trim37tripartite motif-containing 37107194338472075563Rat
1308356N4bp3Nedd4 binding protein 3103589803135906704Rat
1311296Camta2calmodulin binding transcription activator 2105538345055401838Rat
1559716Ern1endoplasmic reticulum to nucleus signaling 1109132688991421201Rat
1559720Cisd3CDGSH iron sulfur domain 3108267934582682376Rat
1306875Arl4dADP-ribosylation factor like GTPase 4D108659205486602843Rat
1306884GrapGRB2-related adaptor protein104629896546352057Rat
1307629Kdm6blysine demethylase 6B105412071654142212Rat
1332603Or2t48eolfactory receptor family 2 subfamily T member 48E104269036842691297Rat
1333627Or1e30-ps1olfactory receptor family 1 subfamily E member 30, pseudogene 1105853934058539976Rat
1310429C10h17orf75similar to human chromosome 17 open reading frame 75106536092465373864Rat
1310432Rdm1RAD52 motif containing 1108656287186573034Rat
1333100Or2y1holfactory receptor family 2 subfamily Y member 1H103360951133610446Rat
1560577Ormdl3ORMDL sphingolipid biosynthesis regulator 3108359005283596035Rat
1334020Or2t48c-ps1olfactory receptor family 2 subfamily T member 48C, pseudogene 1104280110442802047Rat
1334053Or2t45olfactory receptor family 2 subfamily T member 45104348576443486693Rat
1559436Mrc2mannose receptor, C type 2109026198690323187Rat
1359152Ccl7C-C motif chemokine ligand 7106701644667018296Rat
1332615Or2t48dolfactory receptor family 2 subfamily T member 48D104285597242856916Rat
1311365Trappc1trafficking protein particle complex subunit 1105404559854047184Rat
1310708Fndc8fibronectin type III domain containing 8106782595267834090Rat
1310714Cbx1chromobox 1108177030781789981Rat
1310716Ccr10C-C motif chemokine receptor 10108610855186110988Rat
1310723Dhx8DEAH-box helicase 8108666764186704198Rat
1311859Odad4outer dynein arm docking complex subunit 4108548008985508603Rat
1310873Rasl10bRAS-like, family 10, member B106820976168222118Rat
1332828Or1e26-ps1olfactory receptor family 1 subfamily E member 26, pseudogene 1105839491058395850Rat
1310181Ulk2unc-51 like autophagy activating kinase 2104645157846530462Rat
1310324Zswim7zinc finger, SWIM-type containing 7104695331146969800Rat
1310333Itga3integrin subunit alpha 3107999016080022206Rat
1311882Epxeosinophil peroxidase107266686572677952Rat
1311464Fbxo39F-box protein 39105692969956934911Rat
1311470Psmd3proteasome 26S subunit, non-ATPase 3108364347383655620Rat
1359186Olr1469olfactory receptor Olr1469105802506658026010Rat
1359211Dcakddephospho-CoA kinase domain containing108795773887989002Rat
1311972Nfe2l1NFE2 like bZIP transcription factor 1108179605581812926Rat
1333324Or2t51-ps1olfactory receptor family 2 subfamily T member 51, pseudogene 1104294152542941822Rat
1309725Dvl2dishevelled segment polarity protein 2105472335654732823Rat
1310780Hoxb3homeo box B3108125873981314134Rat
1310783Cnot6CCR4-NOT transcription complex, subunit 6103397878534031025Rat
1332601Or4d2olfactory receptor family 4 subfamily D member 2107269711572698050Rat
1311289Spag9sperm associated antigen 9107894343979077797Rat
1311564Ypel2yippee-like 2107174630871803843Rat
1311573Mmp28matrix metallopeptidase 28106824113868264866Rat
1311429Kansl1KAT8 regulatory NSL complex subunit 1108923766789368735Rat
1333915Or3a10-ps1olfactory receptor family 3 subfamily A member 10, pseudogene 1105895514458956290Rat
1311347Pipoxpipecolic acid and sarcosine oxidase106276987462783484Rat
1311967Tubd1tubulin, delta 1107136793671391387Rat
1333571Or2y1colfactory receptor family 2 subfamily Y member 1C103371783133718760Rat
1332806Or2y11olfactory receptor family 2 subfamily Y member 11103384475833845693Rat
1332809Or9e1olfactory receptor family 9 subfamily E member 1104357779443578720Rat
1309043Tmem106atransmembrane protein 106A108650690886515915Rat
1312040Senp3SUMO specific peptidase 3105439069854399590Rat
1560397Msi2musashi RNA-binding protein 2107314376073510566Rat
1359156Spata32spermatogenesis associated 32108815324088164389Rat
1333612Or1e27bolfactory receptor family 1 subfamily E member 27B105843438958435327Rat
1333616Or1e29-ps1olfactory receptor family 1 subfamily E member 29, pseudogene 1105857792158578858Rat
1332851Or1e20bolfactory receptor family 1 subfamily E member 20B105815180858152746Rat
1332756Or1e22olfactory receptor family 1 subfamily E member 22105817700158177939Rat
1332757Or1e31olfactory receptor family 1 subfamily E member 30105854602058546952Rat
1310907Tlk2tousled-like kinase 2109015444990248562Rat
1308998Abca6ATP binding cassette subfamily A member 6109514280595212087Rat
1311635Hexim2HEXIM P-TEFb complex subunit 2108807787088084776Rat
1309121Fbxw11F-box and WD repeat domain containing 11101723273517330574Rat
1309122Hspb9heat shock protein family B (small) member 9108564128485641929Rat
1333990Or2t44bolfactory receptor family 2 subfamily T member 44B104343681843437807Rat
1309561Rnf145ring finger protein 145102900639129050788Rat
1309435Nhp2NHP2 ribonucleoprotein103587705735880399Rat
1560689Psmb3l1proteasome 20S subunit beta 3 like 1103613141536132138Rat
1560541Tmem100transmembrane protein 100107485477974861147Rat
1305664Arhgap44Rho GTPase activating protein 44104965558349822876Rat
1305666Unc45bunc-45 myosin chaperone B106784546467873143Rat
1306907Higd1bHIG1 hypoxia inducible domain family, member 1B108779886487804459Rat
1306908Spdl1spindle apparatus coiled-coil protein 1101926912519294213Rat
1310147Tbc1d9bTBC1 domain family member 9B103445993034497146Rat
1310625Apohapolipoprotein H109334243593356334Rat
1310903Plcd3phospholipase C, delta 3108802670788048080Rat
1309472Slc46a1solute carrier family 46 member 1106336150463367940Rat
1332794Or1x2dolfactory receptor family 1 subfamily X member 2D103537687635377808Rat
1332797Or2ak5g-ps1olfactory receptor family 2 subfamily AK member 5G, pseudogene 1104316213243163041Rat
1307699Mpdu1mannose-P-dolichol utilization defect 1105437471954380301Rat
1306172Rnd2Rho family GTPase 2108639915186402750Rat
1309215Rars1arginyl-tRNA synthetase 1102027074420295192Rat
1309457Med31mediator complex subunit 31105683694456840326Rat
1309380Tnip1TNFAIP3 interacting protein 1103903704839084328Rat
1309255Ccl12C-C motif chemokine ligand 12106707023067071780Rat
1308466Ctnscystinosin, lysosomal cystine transporter105780155157817213Rat
1306524Etv4ETS variant transcription factor 4108670674986721974Rat
1306862Smg8SMG8 nonsense mediated mRNA decay factor107188674271895776Rat
1305232Slc5a10solute carrier family 5 member 10104635206046400795Rat
1305233Havcr2hepatitis A virus cellular receptor 2103088248430914018Rat
1305448Trim11tripartite motif-containing 11104375829943771138Rat
1309957Utp18UTP18 small subunit processome component107881187978839338Rat
1309959Tada2atranscriptional adaptor 2A106896650269014149Rat
1309967Limd2LIM domain containing 2109109027991092772Rat
1308590MlxMAX dimerization protein MLX108601921686024326Rat
1310067Smurf2SMAD specific E3 ubiquitin protein ligase 2109176179891862485Rat
1333969Or2aa1olfactory receptor family 2 subfamily AA member 1104437470244375661Rat
1308010Plekhm1pleckstrin homology and RUN domain containing M1108831383788366182Rat
1305792Krt36keratin 36108503637985040003Rat
1309389Ssh2slingshot protein phosphatase 2106205740062309328Rat
1307084Ska2spindle and kinetochore associated complex subunit 2107192147471939461Rat
1308301Nle1notchless homolog 1106783405967844771Rat
1309290Supt6hSPT6 homolog, histone chaperone and transcription elongation factor106310392063140780Rat
1309400Ift20intraflagellar transport 20106343259763438125Rat
1310093Dhx58DEXH-box helicase 58108562035285631776Rat
1309496Alkbh5alkB homolog 5, RNA demethylase104534488845366331Rat
1308134C10h17orf49similar to human chromosome 17 open reading frame 49105495199154954756Rat
1309092Slc36a3solute carrier family 36, member 3103924353139273433Rat
1306249Krt33akeratin 33A108494258484947544Rat
1305460Ppm1dprotein phosphatase, Mg2+/Mn2+ dependent, 1D107017260370208607Rat
1308696Cdkn2aipnlCDKN2A interacting protein N-terminal like103623113436240569Rat
1310602Ankrd40-ps2ankyrin repeat domain 40, pseudogene 2105591658255917772Rat
1306957Sgsm2small G protein signaling modulator 2105971818059759822Rat
1306961Arhgef15Rho guanine nucleotide exchange factor 15105365052153663269Rat
1306963Mrps23mitochondrial ribosomal protein S23107299903373006791Rat
1306968Lyzl6lysozyme-like 6108854434288549177Rat
1310221Gna13G protein subunit alpha 13109433793994370774Rat
1307639Trarg1trafficking regulator of GLUT4 (SLC2A4) 1106152110761541494Rat
1305970Cd68Cd68 molecule105438181454383693Rat
1305972Rnf167ring finger protein 167105536060355364927Rat
1306673Klhl11kelch-like family member 11108539848785409049Rat
1310963Nlrp1aNLR family, pyrin domain containing 1A105577856055833639Rat
1332804Or1p1eolfactory receptor family 1 subfamily P member 1E105909353159094502Rat
1310113Tnk1tyrosine kinase, non-receptor, 1105457139654580547Rat
1308200Pitpnm3PITPNM family member 3105667469756766552Rat
1310563Ccl9C-C motif chemokine ligand 9106836648668371408Rat
1309285Tanc2tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2109055312490873477Rat
1307835Wsb1WD repeat and SOCS box-containing 1106420276164219039Rat
1307841Mfap4microfibril associated protein 4104616715846170176Rat
1308139Ncbp3nuclear cap binding subunit 3105766571657695432Rat
1308149Zcchc10zinc finger CCHC-type containing 10103747062837481027Rat
1308151Cfap52cilia and flagella associated protein 52105261376152654922Rat
1305300Krt35keratin 35108502617185029568Rat
1308161Mrpl55mitochondrial ribosomal protein L55104398867643991841Rat
708568Rabep1rabaptin, RAB GTPase binding effector protein 1105556615655667595Rat
1306682Mien1migration and invasion enhancer 1108343519883436491Rat
1306683Larp1La ribonucleoprotein 1, translational regulator104219137842246361Rat
1306684Spaca3sperm acrosome associated 3106585061865858090Rat
1306571Arsgarylsulfatase G109441226194551224Rat
1305891Pwwp2aPWWP domain containing 2A102815550928195255Rat
1306620Map2k3mitogen activated protein kinase kinase 3104560814545629492Rat
1306252Aloxe3arachidonate lipoxygenase 3105383021953854328Rat
1308744Dlx4distal-less homeobox 4108008503780090434Rat
1308747PimregPICALM interacting mitotic regulator105666960356674540Rat
1309622Nt5m5',3'-nucleotidase, mitochondrial104465284544680549Rat
1306488Appbp2amyloid beta precursor protein binding protein 2107005777470099877Rat
1306490Tmem101transmembrane protein 101108710511587108868Rat
1309574Wnt9bWnt family member 9B108863533088657035Rat
1309113Hoxb13homeo box B13108116049881162777Rat
1309157Cdc6cell division cycle 6108386418983878011Rat
1310078Sarm1sterile alpha and TIR motif containing 1106336945663393016Rat
1308264Tbx21T-box transcription factor 21108208232282098831Rat
1307184Zbtb4zinc finger and BTB domain containing 4105448069854501492Rat
1309330Scarf1scavenger receptor class F, member 1106035921360371516Rat
1332690Or2ak4colfactory receptor family 2 subfamily AK member 4C104340272743403644Rat
1309057Tbx4T-box transcription factor 4107073068670760829Rat
1311613Spopspeckle type BTB/POZ protein108035812180438983Rat
1311618ItkIL2-inducible T-cell kinase103075334430814685Rat
1307095Rab5cRAB5C, member RAS oncogene family108564255385666142Rat
1307110Ftsj3FtsJ RNA 2'-O-methyltransferase 3109118094591187389Rat
1310239Gp1baglycoprotein Ib platelet subunit alpha105535293855355804Rat
1310240Mettl2methyltransferase like 2109009552790109354Rat
1308004Shpksedoheptulokinase105781755157841981Rat
1307851FAM187Afamily with sequence similarity 187, member A108785086187852332Rat
1308709Tm4sf5transmembrane 4 L six family member 5105521938455225742Rat
1310166Chct1CHD1 helical C-terminal domain containing 1107003951070051556Rat
1309638Guk1guanylate kinase 1104397151443988658Rat
1305467Prpf8pre-mRNA processing factor 8106033149460354606Rat
1306182Phospho1phosphoethanolamine/phosphocholine phosphatase 1108076206280769596Rat
1309863Nsrp1nuclear speckle splicing regulatory protein 1106188080761914471Rat
1310306Mtmr4myotubularin related protein 4107239341172416342Rat
1306625Smim23small integral membrane protein 23101740345617407091Rat
1306633Zfp39zinc finger protein 39104365644443679743Rat
1309231Emc6ER membrane protein complex subunit 6105779407257795671Rat
1308838Krt23keratin 23108443444584450773Rat
1308781Septin4septin 4107236672972390764Rat
1310298Hoxb1homeo box B1108133150781332928Rat
1310274Clk4CDC-like kinase 4103552338235541387Rat
1306944Rad51dRAD51 paralog D106780572067824452Rat
1306948Copz2COPI coat complex subunit zeta 2108183244181845514Rat
1307642Alox12earachidonate 12-lipoxygenase, epidermal105503439255041857Rat
1307645Rapgef6Rap guanine nucleotide exchange factor 6103865585438824227Rat
1307659Brip1BRCA1 interacting helicase 1107090726671031502Rat
1309320Top3aDNA topoisomerase III alpha104541921945457356Rat
1309845Zmynd15zinc finger, MYND-type containing 15105517119855177812Rat
1311391Vps53VPS53 subunit of GARP complex106091982061038674Rat
1332706Olr1433olfactory receptor 1433104304242743046293Rat
1332708Or2ak6colfactory receptor family 2 subfamily AK member 6C104314892443149844Rat
1308347Ube2zubiquitin-conjugating enzyme E2Z108099781681016936Rat
1308449Septin8septin 8103768464937713704Rat
1306138Samd14sterile alpha motif domain containing 14107995711179972347Rat
1309451Sec24aSEC24 homolog A, COPII coat complex component103594690136024353Rat
1309452Nipal4NIPA-like domain containing 4103058392630600640Rat
1310531Pank3pantothenate kinase 3102022912920252955Rat
1308056Neurl4neuralized E3 ubiquitin protein ligase 4105462492354637262Rat
1308057Wnt3aWnt family member 3A104403417444078366Rat
1308058Vezf1vascular endothelial zinc finger 1107285966972876111Rat
1308062Sgcasarcoglycan, alpha107990469879922808Rat
1308212Wscd1WSC domain containing 1105638585856426442Rat
1333440Or2y1olfactory receptor family 2 subfamily Y member 1103374878133759730Rat
1332858Or1e20-ps1olfactory receptor family 1 subfamily E member 20, pseudogene 1105822292158223861Rat
1308868Txndc17thioredoxin domain containing 17105683274956835721Rat
1308869Akap10A-kinase anchoring protein 10104654537146608730Rat
1308881GhdcGH3 domain containing108569361285697833Rat
1308885Trim41tripartite motif-containing 41103317521333186472Rat
1308911Meox1mesenchyme homeobox 1108681845086837563Rat
1308924Tax1bp3Tax1 binding protein 3105779584557800363Rat
1308617Zfp287zinc finger protein 287104739565047415610Rat
1307929Bltp2bridge-like lipid transfer protein family member 2106315599963185213Rat
1307935Dhrs11dehydrogenase/reductase 11106969821469708294Rat
1332792Or2y1eolfactory receptor family 2 subfamily Y member 1E103362385933624794Rat
1309655Cep95centrosomal protein 95109173211191760095Rat
1308813Ccdc47coiled-coil domain containing 47109113030391148829Rat
1307903Stxbp4syntaxin binding protein 4107530186875458741Rat
1310354Usp22ubiquitin specific peptidase 22104582861945855468Rat
1310573Rnf222ring finger protein 222105359675153603305Rat
1310582Tekt3tektin 3104772963547763589Rat
1309673P4ha2prolyl 4-hydroxylase subunit alpha 2103824313638271983Rat
1310352C10h5orf15similar to human chromosome 5 open reading frame 15103656398936576593Rat
1308492RpainRPA interacting protein105569241055699910Rat
1308500Rai1retinoic acid induced 1104491323145008232Rat
1309595Taf15TATA-box binding protein associated factor 15106827292168304951Rat
1309598Ankfy1ankyrin repeat and FYVE domain containing 1105731224657383964Rat
1309530Krt28keratin 28108431835284328693Rat
1306158Hoxb9homeo box B9108123731281240818Rat
1309817Tmem11transmembrane protein 11104554275345557570Rat
1305508Dhrs13dehydrogenase/reductase 13106292079162925952Rat
1310144Snf8SNF8 subunit of ESCRT-II108098433780996724Rat
1306193Slc25a39solute carrier family 25, member 39108736249487367358Rat
1310051Lpolactoperoxidase107260695072626220Rat
1333245Or2av9olfactory receptor family 2 subfamily AV member 9104267389042674897Rat
1333252Or1y1-ps1olfactory receptor family 1 subfamily Y member 1, pseudogene 1105879054558791005Rat
1333253Or1e1eolfactory receptor family 1 subfamily E member 1E105875443258755367Rat
1307868Gas2l2growth arrest-specific 2 like 2106822247568229877Rat
1307869Sat2spermidine/spermine N1-acetyltransferase family member 2105434075654343507Rat
1310386Ublcp1ubiquitin-like domain containing CTD phosphatase 1102894569028961103Rat
1308066Shroom1shroom family member 1103762114937631895Rat
1562292Hoxb5homeo box B5108126937281271580Rat
1564189Dock2dedicator of cytokinesis 2101882723719244832Rat
1564190Tlx3T-cell leukemia, homeobox 3101778970617792207Rat
1561384Ccnjlcyclin J-like102799568228053428Rat
1563438Tmem256transmembrane protein 256105455903054560146Rat
1560464Fam98b-ps1family with sequence similarity 98, member B, pseudogene 1103333639133338220Rat
1563668Hmgb1l5high mobility group box 1 like 5103976865839769408Rat
1563746Meiocmeiosis specific with coiled-coil domain108762880787646485Rat
1562012Lyrm9LYR motif containing 9106372571863739772Rat
1333783Or4d2bolfactory receptor family 4 subfamily D member 2B107269301472693949Rat
1333058Or1r1olfactory receptor family 1 subfamily R member 1105889035758891301Rat
1559538Sco1synthesis of cytochrome C oxidase 1105174465651757246Rat
1566425Tmem199transmembrane protein 199106340249363407065Rat
1563885Borcs6BLOC-1 related complex subunit 6105376050453762358Rat
1563889Fbxw10F-box and WD repeat domain containing 10104751331347551909Rat
1559753Lrrc37aleucine rich repeat containing 37A108839583788433519Rat
1563715Gemin4gem (nuclear organelle) associated protein 4106106242061073529Rat
1563924Cdc42se2CDC42 small effector 2103883654938905056Rat
1565061Spem2SPEM family member 2105453716854539026Rat
1559732Btnl10butyrophilin like 10104369408343701800Rat
1561932Cfap144cilia and flagella associated protein 144104350982343519693Rat
1565925Ccdc42coiled-coil domain containing 42105328995653300135Rat
1564618Shisa6shisa family member 6105089774051192111Rat
1561950Zfp286azinc finger protein 286A104745046947461267Rat
1563963Pgam1-ps11phosphoglycerate mutase 1, pseudogene 11105144914151480570Rat
1334353Or2v1olfactory receptor family 2 subfamily V member 1103339989133404298Rat
1359595Krt33bkeratin 33B108495583884961673Rat
1562350Uqcrqubiquinol-cytochrome c reductase, complex III subunit VII103758586437589328Rat
1311234Bhlha9basic helix-loop-helix family, member a9106151360961514730Rat
1564516Timd4T-cell immunoglobulin and mucin domain containing 4103118575131221843Rat
1562746Gps2G protein pathway suppressor 2105463736054640542Rat
1565087Dnah2dynein, axonemal, heavy chain 2105414264854268901Rat
1564031Elobl9elongin B like 9107376564173765970Rat
1564036MrnipMRN complex interacting protein103450135934525474Rat
1564337Coa3cytochrome C oxidase assembly factor 3108622019286221173Rat
1562712Gjc2gap junction protein, gamma 2104396264243971358Rat
1311243Dhrs7bdehydrogenase/reductase 7B104550434445537094Rat
1311922Ttll6tubulin tyrosine ligase like 6108108198581118009Rat
1311923Chd3chromodomain helicase DNA binding protein 3105406362954090030Rat
1563179Bcl6bBCL6B, transcription repressor105494090854947022Rat
1563195RangrfRAN guanine nucleotide release factor105367746753678880Rat
1359648Skp1S-phase kinase-associated protein 1103640198736417066Rat
1334321Or1ad6olfactory receptor family 1 subfamily AD member 6103528828135289228Rat
1334326Or2t44olfactory receptor family 2 subfamily T member 44104350363043504622Rat
1564005Ankrd13bankyrin repeat domain 13B106231966062338342Rat
1560850Pik3r6phosphoinositide-3-kinase, regulatory subunit 6105320393053255229Rat
1359691Rflnbrefilin B106089369360899970Rat
1359701Krt32keratin 32108501355185020578Rat
1561299Ace3angiotensin I converting enzyme (peptidyl-dipeptidase A) 3109093335990949035Rat
1560033Gpr179G protein-coupled receptor 179108232456882340448Rat
1561590Sap18-ps1Sin3A associated protein 18, pseudogene 1108665735086657976Rat
1561674Msantd5Myb/SANT DNA binding domain containing 5103551692635526742Rat
1561684Krtap2-4l2keratin associated protein 2-4 like 2108458436484585548Rat
1562656Acsf2acyl-CoA synthetase family member 2107950451079546714Rat
1565729Prss38serine protease 38104415933944163019Rat
1563261Pik3r5phosphoinositide-3-kinase, regulatory subunit 5105313258553200663Rat
1563765Rad51cRAD51 paralog C107220503272231643Rat
1561277ZfplZinc finger protein like104360529543647137Rat
1564452Magmas-ps1mitochondria-associated protein involved in granulocyte-macrophage colony-stimulating factor signal transduction, pseudogene 1108860237988602899Rat
1561781Tmem88transmembrane protein 88105411875254120447Rat
1561041C1qtnf2C1q and TNF related 2102794194827958926Rat
1561050Eno1-ps14enolase 1, pseudogene 14105129963251300633Rat
1559918Hoxb7homeo box B7108125261681256034Rat
1311014Tbx2T-box transcription factor 2107067967070688868Rat
1311017Utp6UTP6 small subunit processome component106489732164927997Rat
1560049Dusp3dual specificity phosphatase 3108692001486933739Rat
1359620Tnfsf12TNF superfamily member 12105440387054413213Rat
1311694Aff4ALF transcription elongation factor 4103749882537579751Rat
1334152Or2y1dolfactory receptor family 2 subfamily Y member 1D103367649733677426Rat
1334155Or5af1colfactory receptor family 5 subfamily AF member 1C104356238443563310Rat
1334158Or3a1g-ps1olfactory receptor family 3 subfamily A member 1G, pseudogene 1105898225058983189Rat
1562694Dph1diphthamide biosynthesis 1106002808160039764Rat
1562698Myo18amyosin XVIIIa106265421862755465Rat
1332722Or2y16olfactory receptor family 2 subfamily Y member 16103369047933691414Rat
1561873Myo15amyosin XVA104527761945335953Rat
1561884Spns3sphingolipid transporter 3105711424757169056Rat
1308121Zfp207zinc finger protein 207106538580765398086Rat
1310487Map3k14mitogen-activated protein kinase kinase kinase 14108816534988215558Rat
1310489Nxnnucleoredoxin106110932261247578Rat
1334253Olr1505olfactory receptor 1505105883756858838503Rat
1334258Or1ad1olfactory receptor family 1 subfamily AD member 1103529974435300667Rat
1559450Tmem102transmembrane protein 102105452390154525997Rat
1359290Rpl17-ps16ribosomal protein L17, pseudogene 16109237373592374368Rat
1559567Cyb5d1cytochrome b5 domain containing 1105411342854117744Rat
1559575RGD1559575similar to novel protein103325214633276364Rat
620002Cdk5rap3CDK5 regulatory subunit associated protein 3108189439381903581Rat
1562411Rnft1ring finger protein, transmembrane 1107131005271322507Rat
1359513Thg1ltRNA-histidine guanylyltransferase 1-like103038792930396579Rat
1311813Gdpd1glycerophosphodiester phosphodiesterase domain containing 1107184049771883936Rat
1333777Or2b11olfactory receptor family 2 subfamily B member 11104435839744359353Rat
1359094Zfp672zinc finger protein 672104249655842512134Rat
1359097Krt25keratin 25108426739984275025Rat
1333308Or2w25-ps1olfactory receptor family 2 subfamily W member 25, pseudogene 1104440245444403521Rat
1559617Naa38N(alpha)-acetyltransferase 38, NatC auxiliary subunit105411775454118913Rat
1359092Krt10keratin 10108433869584343279Rat
1560914Dgkediacylglycerol kinase epsilon107385303073877334Rat
1562272Taf11l1TATA-box binding protein associated factor 11 like 1107378128173783163Rat
1359139Slfn9schlafen family member 9106790910567955912Rat
1359145Krt40keratin 40108449647084502756Rat
1303157Krt24keratin 24108423216384237299Rat
1560728Mief2mitochondrial elongation factor 2104540805545414144Rat
1334012Olr1473-psolfactory receptor pseudogene 1473105810135358102121Rat
1334181Or1e32olfactory receptor family 1 subfamily E member 32105858327058584208Rat
1563202Med11mediator complex subunit 11105516432255165940Rat
1564301Hdac1-ps15Histone deacetylase 1, pseudogene 15101934937419357532Rat
1333989Or1e1olfactory receptor family 1 subfamily E member 1105797551957976463Rat
1312022Sox15SRY-box transcription factor 15105437304554374749Rat
1312025Slfn5schlafen family member 5106788106867895013Rat
1561080Wipf2WAS/WASL interacting protein family, member 2108382106783861634Rat
1562370Ccdc103coiled-coil domain containing 103108784632787849959Rat
1562380Drg2developmentally regulated GTP binding protein 2104525551245269971Rat
1562382Slc47a2solute carrier family 47 member 2104599080646033937Rat
1549701Olr1493olfactory receptor gene Olr1493105849570958496647Rat
1359332Odf4outer dense fiber of sperm tails 4105362859253634525Rat
1559851Hexim1HEXIM P-TEFb complex subunit 1108806280888064920Rat
1559861Vmo1vitelline membrane outer layer 1 homolog105522794455234794Rat
1359115Krt27keratin 27108429868484303967Rat
1359123MycbpapMycbp associated protein107945031979470977Rat
1359124Cyb5d2cytochrome b5 domain containing 2105739426857413336Rat
1359125Omgoligodendrocyte-myelin glycoprotein106446135064464084Rat
1359130Inpp5kinositol polyphosphate-5-phosphatase K106047426260495813Rat
1334077Or2t45bolfactory receptor family 2 subfamily T member 45B104346277543463701Rat
1334078Or1x2colfactory receptor family 1 subfamily O member 2C103536466735365608Rat
1311260Mmgt2membrane magnesium transporter 2104734344647362889Rat
1311692Marchf10membrane associated ring-CH-type finger 10109033278390423109Rat
1333845Or1d2olfactory receptor family 1 subfamily D member 2105921294759213882Rat
1333846Or1x2bolfactory receptor family 1 subfamily X member 2B103533922635340167Rat
1334139Or2y14olfactory receptor family 2 subfamily Y member 14103374889833772292Rat
1333474Olr1484-psolfactory receptor pseudogene 1484105830532158305401Rat
1310987Cyb561cytochrome b-561109087805290888734Rat
1334013Olr1500olfactory receptor 1500105871395058714888Rat
1334088Or2ab1olfactory receptor family 2 subfamily AB member 1104298067942981626Rat
1334096Or2ak6olfactory receptor family 2 subfamily AK member 6104319966843200588Rat
1334190Or1e18olfactory receptor family 1 subfamily E member 18105800925258010196Rat
1359305Psmd12proteasome 26S subunit, non-ATPase 12109243822392457323Rat
631347Myocdmyocardin104983321949928806Rat
1562836Mgat4balpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase B103454891834559229Rat
1562841Fbll1fibrillarin-like 1102025865620260299Rat
1561235Leap2liver enriched antimicrobial peptide 2103758017237581244Rat
1563007Ppp1r2l1protein phosphatase 1, regulatory (inhibitor) subunit 2 like 1105461986354624720Rat
1564168Cep112centrosomal protein 112109336605993833133Rat
1559511Rmnd5brequired for meiotic nuclear division 5 homolog B103588125035892322Rat
1559512Tubb4b-ps3tubulin, beta 4B class IVb, pseudogene 3103534178335343148Rat
1334195Or3a4olfactory receptor family 3 subfamily A member 4105896724458968179Rat
1549767CoasyCoenzyme A synthase108601456686018849Rat
1549768Stard3StAR-related lipid transfer domain containing 3108335732983379873Rat
1559534Eno1l3enolase 1 like 3104338160543382794Rat
1334074Or2t52-ps1olfactory receptor family 2 subfamily T member 52, pseudogene 1104295266342953022Rat
1311159Alox12arachidonate 12-lipoxygenase, 12S type105495826354970542Rat
1333878Or5af1bolfactory receptor family 5 subfamily AF member 1B104352270643523632Rat
1333596Or1ad5olfactory receptor family 1 subfamily AD member 5103530766235308573Rat
1309067Eme1essential meiotic structure-specific endonuclease 1107958671879595515Rat
1309077Mrm3mitochondrial rRNA methyltransferase 3106109592061125421Rat
1311334Wdr81WD repeat domain 81106028196960295374Rat
1359526Ka11type I keratin KA11108516142485164737Rat
1333852Olr1454olfactory receptor 1454104347132243472314Rat
1333854Or1e25olfactory receptor family 1 subfamily E member 25105844633258447270Rat
1359229Nt5c3b5'-nucleotidase, cytosolic IIIB108535848385376340Rat
1359660Icam2intercellular adhesion molecule 2109130860891319536Rat
1334436Or1a1bolfactory receptor family 1 subfamily A member 1B105907023959071183Rat
1559961Myo19myosin XIX106975308269782450Rat
1334083Or1e21olfactory receptor family 1 subfamily E member 21105806991058070845Rat
1560383Krt222keratin 222108418413784196122Rat
1549726Zpbp2zona pellucida binding protein 2108355877283567511Rat
1333856Or1ad8olfactory receptor family 1 subfamily AD member 8103532141835322341Rat
1333858Or2y1iolfactory receptor family 2 subfamily Y member 1I103373719933738128Rat
1332981Olr1471olfactory receptor 1471105805734558058286Rat
1334228Or1e1colfactory receptor family 1 subfamily E member 1C105798641757987370Rat
1562041Rnf130ring finger protein 130103434283534456048Rat
1549751Fkbp10FKBP prolyl isomerase 10108534543485357998Rat
1311123Slc47a1solute carrier family 47 member 1104603411546088617Rat
1311125Slc16a11solute carrier family 16, member 11105492912954933021Rat
1333716Or2ak4b-ps1olfactory receptor family 2 subfamily AK member 4B, pseudogene 1104332812743329042Rat
1332914Or2t29b-ps1olfactory receptor family 2 subfamily T member 29B, pseudogene 1104295849542959431Rat
1564148Mfap1al1microfibrillar-associated protein 1A like 1105333813853343973Rat
1333024Or2v2bolfactory receptor family 2 subfamily V member 2B103337986333380810Rat
1333051Or2ak4eolfactory receptor family 2 subfamily AK member 4E104328914243290062Rat
1333482Or1p1olfactory receptor family 1 subfamily P member 1105913079659131767Rat
1559974Calcoco2calcium binding and coiled-coil domain 2108105546781069298Rat
1333036Or2av10olfactory receptor family 2 subfamily AV member 10104265575042656703Rat
1311189Zzef1zinc finger ZZ-type and EF-hand domain containing 1105741326557550888Rat
1560058Phb1-ps1prohibitin 1, pseudogene 1106654646966547373Rat
1564698Rps10-ps20ribosomal protein S10, pseudogene 20101935774319360370Rat
1333012Or1e16olfactory receptor family 1 subfamily E member 16105827403958274983Rat
1333013Olr1428olfactory receptor 1428104294735342948300Rat
1333017Or1e21bolfactory receptor family 1 subfamily E member 21B105821468758215622Rat
1562251Ccdc69coiled-coil domain containing 69103917328239200358Rat
1563269Rapgefl1Rap guanine nucleotide exchange factor like 1108379371183810373Rat
1359736Tmem98transmembrane protein 98106579617365807082Rat
735194Snap47synaptosome associated protein 47104419288644234435Rat
1332960Olr1518-psolfactory receptor pseudogene 1518105918753959188242Rat
1333732Or2y12olfactory receptor family 2 subfamily Y member 12103380072033801655Rat
1333736Or2t47dolfactory receptor family 2 subfamily T member 47D104288311442884076Rat
1333743Olr1451olfactory receptor 1451104342914043430069Rat
1563134Rpl29l6ribosomal protein L29 like 6105921793159218554Rat
1562309Krtap2-4keratin associated protein 2-4108457795384578426Rat
1311794Abi3ABI family, member 3108076981980780816Rat
1311901Rhbdl3rhomboid like 3106529925065354099Rat
1303044Krt15keratin 15108506679785070614Rat
1560116Eftud2elongation factor Tu GTP binding domain containing 2108780489387852181Rat
1564837Mis12MIS12 kinetochore complex component105573974155747915Rat
1359135Mink1misshapen-like kinase 1105527829355330782Rat
1359182Krt42keratin 42108518518685246520Rat
1359571Timd2T-cell immunoglobulin and mucin domain containing 2103106030831101262Rat
1359436Pigsphosphatidylinositol glycan anchor biosynthesis, class S106322261163237190Rat
1359453Cct6bchaperonin containing TCP1 subunit 6B106765246167701385Rat
1333300Or2v2colfactory receptor family 2 subfamily V member 2C103331984433320791Rat
1560113Hoxb4homeo box B4108128455281287134Rat
1559875Heatr9HEAT repeat containing 9106830912868320650Rat
1566232Mrm1mitochondrial rRNA methyltransferase 1106969040669697326Rat
1565284Pirtphosphoinositide-interacting regulator of transient receptor potential channels105161320251628108Rat
1564542Cntd1cyclin N-terminal domain containing 1108622143086231812Rat
1586382Sox30SRY-box transcription factor 30103041749930446441Rat
727916Rfflring finger and FYVE-like domain containing E3 ubiquitin protein ligase106774071167803669Rat
3380Ppp2caprotein phosphatase 2 catalytic subunit alpha103635811036377864Rat
1566257Rras2-ps1RAS related 2, pseudogene 1104591671945917890Rat
1586044Or2v2olfactory receptor family 2 subfamily V member 2103335195433352895Rat
1565681Cenpvcentromere protein V104721447947228552Rat
1587320Gle1-ps5GLE1 RNA export mediator, pseudogene 5108480289984804597Rat
1587322Rps15-ps10ribosomal protein S15, pseudogene 10106169268061693155Rat
1587323Stmnl-ps1stathmin like, pseudogene 1106485711864857745Rat
1587326Polr2aRNA polymerase II subunit A105445243854478486Rat
1587327Rps2-ps29ribosomal protein S2, pseudogene 29105126154451262251Rat
1583007Slfn1schlafen family member 1106797745867983287Rat
1359604Ttc1tetratricopeptide repeat domain 1102820232528227464Rat
1585798Tubg2tubulin, gamma 2108609120586108053Rat
1559667Btf3-ps15basic transcription factor 3, pseudogene 15104550194645502810Rat
1563106Ctc1CST telomere replication complex component 1105371461453735298Rat
1582743Sbds-ps2Sbds, ribosome maturation factor, pseudogene 2104438817644397730Rat
1585988Xaf1XIAP associated factor 1105691737856929791Rat
1560788Bcas3BCAS3, microtubule associated cell migration factor107021371070673080Rat
1582971Rps23-ps9ribosomal protein S23, pseudogene 9109243427492434789Rat
1566120Meikinmeiotic kinetochore factor103850815638556732Rat
1559806Hmgb1-ps15high-mobility group box 1, pseudogene 15102307433023074956Rat
1561062Fam117afamily with sequence similarity 117, member A108028141180325345Rat
1565522Tmem132etransmembrane protein 132E106733086367386790Rat
1565523Lsm11LSM11, U7 small nuclear RNA associated103036784130385956Rat
1586597Nme1-ps3NME/NM23 nucleoside diphosphate kinase 1, pseudogene 3106513688465137365Rat
1359138Slc16a13solute carrier family 16, member 13105492597354937860Rat
1359248Kif2bkinesin family member 2B107639416076396379Rat
1582887Wbp11-ps7WW domain binding protein 11, pseudogene 7103338302133384950Rat
1587402Spmap1sperm microtubule associated protein 1108276396982768587Rat
1583720Eno1-ps3enolase 1, pseudogene 3108493248884933110Rat
1585065Lypd8l2LY6/PLAUR domain containing 8 like 2104299023742995285Rat
1583877H3f4H3.4 histone, cluster member104374070243741262Rat
1583885H2bu1H2B.U histone 1104373273743733484Rat
1585025Rpl17l5ribosomal protein L17 like 5104536201245364050Rat
1587434Epopelongin BC and polycomb repressive complex 2 associated protein108262439282625912Rat
1563128Arl5cADP-ribosylation factor like GTPase 5C108298521382993425Rat
1565033C10h17orf58similar to human chromosome 17 open reading frame 58109197293891977606Rat
1564228NagluN-acetyl-alpha-glucosaminidase108600154586009049Rat
1566329Zfp652zinc finger protein 652108062655580706397Rat
1561727Proca1protein interacting with cyclin A1106309001863102941Rat
1564616Sowahasosondowah ankyrin repeat domain family member A103764182337645390Rat
1566089Gapdhl6glyceraldehyde-3-phosphate dehydrogenase like 6107596050775968953Rat
1563273Zfp879zinc finger protein 879103514867935158674Rat
1583913Cfl2-ps1cofilin-2, pseudogene 1104359068543591177Rat
1584081Nol11nucleolar protein 11109211900092141688Rat
1565950Adamts2ADAM metallopeptidase with thrombospondin type 1 motif, 2103492099235126465Rat
1563878Asb16ankyrin repeat and SOCS box-containing 16108722597687233078Rat
1562355Atp6v1g1l1ATPase H+ transporting V1 subunit G1 like 1102866397428664273Rat
15595781700012B07RklRIKEN cDNA 1700012B07 gene like109477147194804839Rat
1565783NagsN-acetylglutamate synthase108709833087102465Rat
1559709Fbxo47F-box protein 47108284951482880337Rat
1560191Zfp62zinc finger protein 62103352261833539446Rat
1563281Lrrc3cleucine rich repeat containing 3C108360879783610128Rat
1562928Cxcl16C-X-C motif chemokine ligand 16105516672155171316Rat
1562573Zfp830zinc finger protein 830106770134067702804Rat
1566146Krtap4-3keratin associated protein 4-3108475217384790523Rat
1562276Ccdc92bcoiled-coil domain containing 92B105947979859501486Rat
1561189Retreg3reticulophagy regulator family member 3108602876786052575Rat
1562610Zfp2zinc finger protein 2103520918735228849Rat
1563555Garin3golgi associated RAB2 interactor family member 3103082987730833115Rat
1563563Ppid-ps13peptidylprolyl isomerase D, pseudogene 13107980080779804238Rat
1562142Hoxb6homeo box B6108125872681267458Rat
1564621Smcr8SMCR8-C9orf72 complex subunit104545796245465101Rat
1564623Ovca2OVCA2 serine hydrolase domain containing106002604860029211Rat
1564778Msl1MSL complex subunit 1108375538083767147Rat
1564411Slfn3schlafen family member 3106802048268060248Rat
1562626Tom1l1target of myb1 like 1 membrane trafficking protein107546457775508304Rat
1559552Med1mediator complex subunit 1108314553883189260Rat
1584011Wbp11-ps6WW domain binding protein 11, pseudogene 6103332301233325107Rat
1561735Slc22a21solute carrier family 22 (organic cation transporter), member 21103810411438133106Rat
1359463Mfap3microfibril associated protein 3104169678841711490Rat
1562576Ranbp17RAN binding protein 17101780040618102947Rat
1562577Actb-ps10actin, beta, pseudogene 10109214217692143796Rat
1566204Heatr6HEAT repeat containing 6106863504868665445Rat
1561464Atad5ATPase family, AAA domain containing 5106507068265118489Rat
1565533Cfap97d1CFAP97 domain containing 1108693358586944566Rat
1561650Aarsd1alanyl-tRNA synthetase domain containing 1108634062586353732Rat
1566174Trim58tripartite motif-containing 58104302293343038984Rat
1566149Fam222bfamily with sequence similarity 222, member B106298657163052350Rat
1565186Mks1MKS transition zone complex subunit 1107265592172667007Rat
1359618Dhx40DEAH-box helicase 40107158454671621479Rat
1565611Liat1ligand of ATE1106087252960876191Rat
1565378Spata22spermatogenesis associated 22105794527257963081Rat
1561602Nlknemo like kinase106346738863590960Rat
1584376Cd300lgCd300 molecule-like family member G108699188687009248Rat
61861Gabra6gamma-aminobutyric acid type A receptor subunit alpha6102681041126825768Rat
1561262Hs3st3a1heparan sulfate-glucosamine 3-sulfotransferase 3A1104909285049180676Rat
1564531Trpv3transient receptor potential cation channel, subfamily V, member 3105788354657915865Rat
1561281Krtap2-1keratin associated protein 2-1108457216484572587Rat
1562631Tlcd2TLC domain containing 2106031057760314263Rat
1359624Wrap53WD repeat containing, antisense to TP53105428209254299908Rat
1563441Rnf227ring finger protein 227105406105454063015Rat
1563442Zfp385czinc finger protein 385C108556200385618100Rat
1564565Med24mediator complex subunit 24108366460983702315Rat
1563669Med9mediator complex subunit 9104475066744765464Rat
1561538Slfn14schlafen family member 14106807632668087794Rat
1561541Prr11proline rich 11107189885871943325Rat
1582982Gsta4l1glutathione S-transferase, alpha 4 like 1106800729768007919Rat
1582808Ttc19tetratricopeptide repeat domain 19104696972346997607Rat
1565126Atp10bATPase phospholipid transporting 10B102749520727751313Rat
1565317Faul2FAU ubiquitin like and ribosomal protein S30 fusion like 2106412475964125452Rat
1582828HlfHLF transcription factor, PAR bZIP family member107515424475211884Rat
1586325Dppa1developmental pluripotency associated 1103099804931017756Rat
1592933Krtap9-7keratin associated protein 9-7108481375484814326Rat
1592397Prr15lproline rich 15-like108191649181922454Rat
1592404Rpl15-ps8ribosomal protein L15, pseudogene 8108083034580831058Rat
1592405B4galnt2beta-1,4-N-acetyl-galactosaminyl transferase 2108080159480828005Rat
1592414Rsad1radical S-adenosyl methionine domain containing 1107948525379499616Rat
1591208Atp6v0c-ps1ATPase H+ transporting V0 subunit C, pseudogene 1108757454487584265Rat
1592971Or1e35olfactory receptor family 1 subfamily E member 35105877702858777966Rat
1592386Pgap3post-GPI attachment to proteins phospholipase 3108338711383399357Rat
1592387Tcaptitin-cap108338171983382887Rat
1586365Rpl27a-ps10ribosomal protein L27a, pseudogene 10107292864072929715Rat
1593783Nsmce2-ps2NSE2/MMS21 homolog, SMC5-SMC6 complex SUMO ligase, pseudogene 2106378607563790665Rat
1591123Rps19-ps17ribosomal protein S19, pseudogene 17102609697226097422Rat
1592078Sp2Sp2 transcription factor108194058081970040Rat
1592079Mmdmonocyte to macrophage differentiation-associated107507327875101528Rat
1592080Ndufa13-ps2NADH:ubiquinone oxidoreductase subunit A13, pseudogene 2107368790473688917Rat
1592081Mpomyeloperoxidase107259488372608862Rat
1585960Smtnl2smoothelin-like 2105700832257029505Rat
1592433C10h17orf67similar to human chromosome 17 open reading frame 67107389534373916133Rat
1592316Api5-ps2apoptosis inhibitor 5, pseudogene 2102547255025474210Rat
1590287Btnl9butyrophilin-like 9103346605933489229Rat
1593000Krtap9-1keratin associated protein 9-1108479664384797404Rat
1590981Rps9-ps12ribosomal protein S9, pseudogene 12103660391436604743Rat
1591007Gngt2G protein subunit gamma transducin 2108077600380784235Rat
1592448Hsf5heat shock transcription factor 5107241721672460394Rat
1585017Adam19ADAM metallopeptidase domain 19103049136230583115Rat
1585207Surf6-ps2surfeit 6, pseudogene 2103117475631176633Rat
1586495Ccl1C-C motif chemokine ligand 1106712833167131109Rat
1584685Vps25vacuolar protein sorting 25 homolog108619606286201606Rat
1589060Rprmlreprimo-like108856024888561252Rat
1586539Tvp23btrans-golgi network vesicle protein 23 homolog B104755378947565203Rat
1586211Hoxb8homeo box B8108124831381251261Rat
1565459Mifl4macrophage migration inhibitory factor like 4109419199894192520Rat
1586284Faxdc2fatty acid hydroxylase domain containing 2104224580842271679Rat
2592Fabp6fatty acid binding protein 6102806360328068276Rat
1589910Rps2-ps35ribosomal protein S2, pseudogene 35102814493228146035Rat
1591196Gstp1-ps2glutathione S-transferase pi 1, pseudogene 2108949816989499906Rat
1591197Myl4myosin, light chain 4108944945689485365Rat
1586275Gemin5gem (nuclear organelle) associated protein 5104229572942342902Rat
1565881Zfp3zinc finger protein 3105547842455486686Rat
1589937Atp5if1-ps2ATP synthase inhibitory factor subunit 1, pseudogene 2102811183328112277Rat
1588526Tpm1-ps1tropomyosin 1, pseudogene 1102420778924208973Rat
1588527Thrap3-ps2thyroid hormone receptor associated protein 3, pseudogene 2102269983922705360Rat
1590899Cactin-ps2cactin, spliceosome C complex subunit, pseudogene 2109014221190155347Rat
1590900Pno1-ps1partner of NOB1 homolog (S. cerevisiae), pseudogene 1108734603987347309Rat
1590901Krt16keratin 16108516835785171816Rat
1590902Cct6a-ps2chaperonin containing Tcp1, subunit 6A (zeta 1), pseudogene 2108470494584706933Rat
1584857Or2ak4folfactory receptor family 2 subfamily AK member 4F104324767043248539Rat
1584858Gins4-ps1GINS complex subunit 4, pseudogene 1102893193928933904Rat
1587490Srsf1serine and arginine rich splicing factor 1107283892672859066Rat
1303002Cops3COP9 signalosome subunit 3104461811544652807Rat
61885Pitpnaphosphatidylinositol transfer protein, alpha106043071260473564Rat
1588894Gid4GID complex subunit 4104522155645247627Rat
1586225Lypd9LY6/PLAUR domain containing 9104262649942637182Rat
1586251Lypd8Ly6/Plaur domain containing 8104256183442572684Rat
1586234Bpifb9aBPI fold containing family B, member 9A104259582242600781Rat
1590933Ybx1-ps20Y box binding protein 1, pseudogene 20103916118439162722Rat
1587037Rpl37-ps4ribosomal protein L37, pseudogene 4106020905660209726Rat
1585185Hils1histone linker H1 domain, spermatid-specific 1107991352579914321Rat
1590939Sh3bp5lSH3 binding domain protein 5 like104251243742529564Rat
1593289Pyypeptide YY108706115587062278Rat
1593294Nlrp1bNLR family, pyrin domain containing 1B105583838155904374Rat
15932976330403K07RiklRIKEN cDNA 6330403K07 gene like105575561155757162Rat
1593299ScimpSLP adaptor and CSK interacting membrane protein105550764655527764Rat
1593301Rpl36al-ps2ribosomal protein L36A, pseudogene 2105534345755343858Rat
1593310Tmem95transmembrane protein 95105459979954601746Rat
1593311Spem1spermatid maturation 1105454145454542755Rat
1596210Or1e1dolfactory receptor family 1 subfamily E member 1D105886204858862983Rat
1596224Olr1468-ps1olfactory receptor 1468, pseudogene 1105865364758654541Rat
1595464Krtap4-7l2keratin associated protein 4-7 like 2108459217884592759Rat
1596391Lyrm7LYR motif containing 7103896429938983628Rat
1595518Krtap1-3keratin associated protein 1-3108455287384553394Rat
1597447C10h17orf50similar to human chromosome 17 open reading frame 50106823886068242437Rat
1595918Smg6SMG6 nonsense mediated mRNA decay factor105978625860014395Rat
1596488Rskrribosomal protein S6 kinase related106318528663191963Rat
1592427Mbtd1mbt domain containing 1107883914078895413Rat
1591746Krtap31-1keratin associated protein 31-1108486305084863982Rat
1591758Krtap31-2keratin associated protein 31-2108484992084850903Rat
1592062Gsdmagasdermin A108361433683639543Rat
1591772LOC680428hypothetical protein LOC680428108483952184840381Rat
1595947Lrrc75aleucine rich repeat containing 75A104729822247343301Rat
1596828Krtap3-2keratin associated protein 3-2108451863484518964Rat
1596207Or1e1fl1olfactory receptor family 1 subfamily E member 1F like 1105887515558876105Rat
1593396Cycsl2cytochrome c, somatic like 2103532403835324419Rat
1593534Mat2bmethionine adenosyltransferase 2 non-catalytic beta subunit102510692825122982Rat
1588626Mrpl10mitochondrial ribosomal protein L10108202603182034451Rat
1592359Rpl37a-ps3ribosomal protein L37A, pseudogene 3106983830469838667Rat
1590296Or2m13olfactory receptor family 2 subfamily M member 13103346033733461275Rat
1593405Tmem92transmembrane protein 92107974924279760807Rat
1593411Hint1histidine triad nucleotide binding protein 1103898951638993259Rat
1594586Gapdh-ps107Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 107107724356177246188Rat
1594623Cox10cytochrome c oxidase assembly factor heme A:farnesyltransferase COX10104863099348742805Rat
1595998Tnfrsf13bTNF receptor superfamily member 13B104580186045824932Rat
1596844Adk-ps1adenosine kinase, pseudogene 1108451316184514263Rat
1597232Rps4x-ps6ribosomal protein S4, X-linked, pseudogene 6104525177645252623Rat
1593331Rps4x-ps7ribosomal protein S4, X-linked, pseudogene 7105364216453643101Rat
1593242Mettl16methyltransferase 16, RNA N6-adenosine105964091559697291Rat
1597577C10h17orf107similar to human chromosome 17 open reading frame 107105533206755333199Rat
1594396Trim25tripartite motif-containing 25107381281873831271Rat
1589570Or2t26olfactory receptor family 2 subfamily T member 26103344654033447493Rat
1596276Haspinhistone H3 associated protein kinase105774773157750518Rat
1594715Cby3chibby family member 3103468092634683176Rat
1586332Havcr1l2hepatitis A virus cellular receptor 1 like 2103096305830983169Rat
1596222Or1e34olfactory receptor family 1 subfamily E member 34105866765758668595Rat
1593621Suz12SUZ12 polycomb repressive complex 2 subunit106496703565012916Rat
1595488Krtap2-4l1keratin associated protein 2-4-like 1108456395084564373Rat
1596817Krtap3-1keratin associated protein 3-1108452769884527994Rat
1586338Ccdc182coiled-coil domain containing 182107309022873091040Rat
1595962Tmed4-ps1transmembrane p24 trafficking protein 4, pseudogene 1104723234847236981Rat
1595972Tmem107transmembrane protein 107105377215353774685Rat
1596776Bax-ps2BCL2-associated X protein, pseudogene 2108652465886533056Rat
1596463Gpatch8G patch domain containing 8108743202087512594Rat
1597047Pitpnc1phosphatidylinositol transfer protein, cytoplasmic 1109216355892428971Rat
1593257Krt18-ps1keratin 18, pseudogene 1106487762364880512Rat
1593824Evi2aecotropic viral integration site 2A106448576064489660Rat
1598226Znhit3zinc finger, HIT-type containing 3106977588569790471Rat
1598228Ubap2l-ps1ubiquitin-associated protein 2-like, pseudogene 1105899013158993082Rat
1598229Slc25a35solute carrier family 25, member 35105367285153677501Rat
1598224Krtap1-5keratin associated protein 1-5108454328884543711Rat
1596719Nufip2nuclear FMR1 interacting protein 2106257492262607729Rat
1596730Ndufv3-ps2NADH:ubiquinone oxidoreductase subunit V3, pseudogene 2108674437886751105Rat
1597401Rpl10a-ps5ribosomal protein L10A, pseudogene 5109417369994175006Rat
1594678Ankrd40ankyrin repeat domain 40107928207579295322Rat
1596428Itga2bintegrin subunit alpha 2b108740853287426055Rat
1642427Zfp867zinc finger protein 867104424481344255223Rat
2293818Phykpl5-phosphohydroxy-L-lysine phospho-lyase103583996535863631Rat
2303312Spns2SPNS lysolipid transporter 2, sphingosine-1-phosphate105706734857105969Rat
2303824Usp43ubiquitin specific peptidase 43105254920052611168Rat
2319718Efcab15EF-hand calcium binding domain 15108814338288153693Rat
2318500Rpl15-ps6ribosomal protein L15, pseudogene 6104441792844418542Rat
2319111Krtap4-7keratin associated protein 4-7108459908884599579Rat
2318578Krtap16-1keratin associated protein 16-1108491511684916984Rat
2318580Fndc9fibronectin type III domain containing 9103066443530668213Rat
2319914Psmg4-ps2proteasome assembly chaperone 4, pseudogene 2108098672680987180Rat
2318090Anos1-ps1anosmin 1, pseudogene 1106859383768594709Rat
2318138Anos1anosmin 1106856195468562801Rat
2318188LOC10036240060S ribosomal protein L13-like103910273839104222Rat
2318794Krtap1-5l1keratin associated protein 1-5 like 1108455952184559916Rat
2319448Hax1-ps2HCLS1 associated protein X-1, pseudogene 2103132788831329144Rat
2320105Insyn2binhibitory synaptic factor family member 2B101891672119023859Rat
2319497Tomm7-ps4translocase of outer mitochondrial membrane 7, pseudogene 4105524649955253279Rat
2319509Hoxb2homeobox B2108131782881320220Rat
2318339Fnip1folliculin interacting protein 1103856772838650824Rat
2318949Krtap4-6keratin associated protein 4-6108462778284628519Rat
2318953Rpl30l2ribosomal protein L30-like 2103683150436831985Rat
2319558Stk17b-ps1serine/threonine kinase 17b, pseudogene 1104268398842685078Rat
2320203Krtap9-5lkeratin associated protein 9-5 like108487709884880040Rat
2319678Snu13-ps1small nuclear ribonucleoprotein 13, pseudogene 1102441155924412088Rat
2322743Hars2l1histidyl-tRNA synthetase 2 like 1103313993633141734Rat
2322150Tsr1TSR1, ribosome maturation factor105976042059771868Rat
2322151Eif3i-ps3eukaryotic translation initiation factor 3, subunit I, pseudogene 3103364790133648990Rat
2321462Sdhd-ps2succinate dehydrogenase complex subunit D, pseudogene 2103666551736665975Rat
2322220Elobl2elongin B like 2107375751773758022Rat
2322885Rpl30-ps1ribosomal protein L30, pseudogene 1103312940633130617Rat
2321564LOC100364194transmembrane protein 92-like107970720379710867Rat
2322930Car10carbonic anhydrase 10107805587578556490Rat
2322345Fam83gfamily with sequence similarity 83, member G104636302946388030Rat
2322976Rps24-ps15ribosomal protein S24, pseudogene 15107628936576289879Rat
2323022Tom1l3target of myb1 like 3 membrane trafficking protein107550835475514764Rat
2321712Ubbl2ubiquitin B like 2104791045847910703Rat
2323127Ly6e-ps2lymphocyte antigen 6 family member E, pseudogene 2105828770758288311Rat
2322499Rpl31l2ribosomal protein L31-like 2103337529633375771Rat
2321071Csnk2a1-ps1casein kinase 2 alpha 1, pseudogene 1103827522838276101Rat
2322651Wbp11-ps8WW domain binding protein 11, pseudogene 8103335512933358199Rat
2323463Havcr1l1hepatitis A virus cellular receptor 1 like 1103091986030941388Rat
2323480Ly6e-ps1lymphocyte antigen 6 family member E, pseudogene 1105801110558011735Rat
2324311Cox7b-ps4cytochrome c oxidase subunit 7B, pseudogene 4106980229669803207Rat
2323679Nos2-ps1nitric oxide synthase 2, pseudogene 1106388755263905593Rat
4888546Mir193amicroRNA 193a106467234364672454Rat
2323798Rpl37al1ribosomal protein L37A like 1105385911753859712Rat
2323819Dctpp1-ps1dCTP pyrophosphatase 1, pseudogene 1104460856944609566Rat
2325346Mir195microRNA 195105495183854951924Rat
2325359Mir423microRNA 423106191414261914220Rat
2325364Mir497microRNA 497105495151454951582Rat
2325371Mir365bmicroRNA 365b106468625564686340Rat
2325376Mir212microRNA 212106002340360023513Rat
2325379Mir193microRNA 193106467235464672439Rat
2325382Mir146amicroRNA 146a102784851627848610Rat
2325403Mir336microRNA 336103418557934185674Rat
2325405Mir301amicroRNA 301a107192533671925435Rat
2325418Mir196cmicroRNA 196c108123100681231085Rat
2325428Mir144microRNA 144106296134862961430Rat
2325436Mir324microRNA 324105473468054734762Rat
2323961Cdrt4CMT1A duplicated region transcript 4104762547047657493Rat
2325479Mir632microRNA 632106538575765385834Rat
2325534Mir451amicroRNA 451a106296152062961591Rat
2325546Mir218-2microRNA 218-2102006845120068560Rat
2325564Mir152microRNA 152108183293681833020Rat
2325567Mir142microRNA 142107255786472557950Rat
2325572Mir132microRNA 132106002369660023796Rat
2325579Mir103a1microRNA 103a-1102024441220244497Rat
2325597Mir22microRNA 22106030703960307133Rat
2325598Mir21microRNA 21107140525771405348Rat
2325601Mir10amicroRNA 10a108128317181283280Rat
2324125Irgm2immunity-related GTPase family M member 2104238945242399604Rat
2324575Krtap1-1keratin associated protein 1-1108454576584546331Rat
6489771LOC100911946uncharacterized LOC100911946105261126752613149Rat
6488368LOC100912202uncharacterized LOC100912202109461743494621315Rat
6489971Elobl3elongin B like 3107377428673774648Rat
6488615Rpl18-ps6ribosomal protein L18, pseudogene 6104426352344264312Rat
6486111LOC100912629uncharacterized LOC100912629108914812389152191Rat
6486207Krtap4-3l1keratin associated protein 4-3 like 1108461250684620724Rat
6486396Krtap4-9keratin associated protein 4-9108473988184740603Rat
6486589C10h17orf100similar to human chromosome 17 open reading frame 100105684045156843674Rat
6495127LOC100911111uncharacterized LOC100911111104378210443786129Rat
6494481Med7mediator complex subunit 7103084233030857873Rat
6493616LOC100911361heterogeneous nuclear ribonucleoprotein A3-like107821773378219237Rat
6502209Bola2-ps5bolA family member 2, pseudogene 5106262745862632944Rat
6502228Wfdc18l1WAP four-disulfide core domain 18 like 1106853903568541169Rat
6495961Evi2becotropic viral integration site 2B106447269364474311Rat
6499350Trappc2btrafficking protein particle complex 2B103593822535942869Rat
6499408Rpl15-ps7ribosomal protein L15, pseudogene 7105144754451448165Rat
6496100Derl2derlin 2105572776455739442Rat
6503260LOC100909494keratin-associated protein 4-7-like108474549984746100Rat
6496829LOC100910814keratin-associated protein 9-1-like108481965284820206Rat
6497567Rpl10a-ps6ribosomal protein L10A, pseudogene 6105377667453779927Rat
6498388Prdx6-ps1peroxiredoxin 6, pseudogene 1105360919753610539Rat
7517962C10h17orf78similar to human chromosome 17 open reading frame 78106903488769054100Rat
7518009LOC102553843uncharacterized LOC102553843103589252435895226Rat
7518044Ube2i-ps4ubiquitin-conjugating enzyme E2I, pseudogene 4106970188169702956Rat
7518371LOC102555997uncharacterized LOC102555997104374639043758445Rat
7489039Mir6326microRNA 6326106030678660306896Rat
7522823LOC102557028uncharacterized LOC102557028103328644133303560Rat
7523178LOC102554159uncharacterized LOC102554159105004628650199221Rat
7527073LOC102557224uncharacterized LOC102557224105419771454201762Rat
7489011Mir6327microRNA 6327106659835166598483Rat
7527442LOC102552952uncharacterized LOC102552952104761660147625398Rat
7527654LOC102546527uncharacterized LOC102546527108678355786788279Rat
7529341LOC102550334uncharacterized LOC102550334109404316194103566Rat
7529496Znf454zinc finger protein 454103518372935200450Rat
7501583LOC102546946uncharacterized LOC102546946104559053045595233Rat
7503123LOC102547047uncharacterized LOC102547047108069506780762037Rat
7497167LOC102555790uncharacterized LOC102555790107955293479561494Rat
7502415Nogl1noggin like 1107412453474133881Rat
7503661LOC102557019uncharacterized LOC102557019107991863579929063Rat
7516121LOC102550051uncharacterized LOC102550051106471663564738279Rat
7517671LOC102554449uncharacterized LOC102554449108508026085086577Rat
7519974LOC102551552uncharacterized LOC102551552106278035562783832Rat
7612562Ccdc200coiled-coil domain containing 200108651770486523106Rat
7613436LOC102557529uncharacterized LOC102557529107310226273112961Rat
7632735Rps15a-ps2ribosomal protein S15a, pseudogene 2106895205268952509Rat
7648353LOC102550111uncharacterized LOC102550111108753824387552344Rat
7664110LOC102546446uncharacterized LOC102546446108679466486801737Rat
7614296LOC102547395uncharacterized LOC102547395105633737456348553Rat
7614463Slfn4l1schlafen family member 4 like 1106806463668068031Rat
7615022LOC102548672uncharacterized LOC102548672102632406226428093Rat
7649594Dbf4bDBF4B-CDC7 kinase regulatory subunit108771380587719197Rat
7650056LOC102546698uncharacterized LOC102546698109143517591435535Rat
7650893LOC102547851uncharacterized LOC102547851105655855556622104Rat
7651542Rpl23a-ps1ribosomal protein L23a, pseudogene 1109491637594916960Rat
7558326Pgam1-ps3phosphoglycerate mutase 1, pseudogene 3106512448665130349Rat
7622441LOC102549294uncharacterized LOC102549294106065320560724367Rat
7558982LOC102552882uncharacterized LOC102552882104050900640600404Rat
7625432LOC102553022uncharacterized LOC102553022104060050540667976Rat
7625474LOC102550846uncharacterized LOC102550846109431685794318116Rat
7655392Rpl12-ps6ribosomal protein L12, pseudogene 6106503209765033557Rat
7595653LOC102553190uncharacterized LOC102553190106940451069414681Rat
7642598Spem3SPEM family member 3105453208354536318Rat
7629087Rpl35l5ribosomal protein L35 like 5107565667275707890Rat
7644068Rpl37a-ps13ribosomal protein L37A, pseudogene 13106319123863195267Rat
7660262LOC102546598uncharacterized LOC102546598108025568080267072Rat
7610492Polr2l-ps3RNA polymerase II, I and III subunit L, pseudogene 3108669637186697618Rat
7644542LOC102546326uncharacterized LOC102546326103545689035471882Rat
7611738Krtap17-1keratin associated protein 17-1108492392084924634Rat
7555271LOC102553349uncharacterized LOC102553349104106391341126313Rat
7616496Gpx4-ps2glutathione peroxidase 4, pseudogene 2106046700960467698Rat
7616564LOC102554726uncharacterized LOC102554726105160857151614414Rat
7617190Tmem238ltransmembrane protein 238 like105164787151662206Rat
7593322LOC102549418uncharacterized LOC102549418104489281744907459Rat
7592181LOC102550168uncharacterized LOC102550168106466391964665250Rat
7572891Krtap4-7l1keratin associated protein 4-7 like 1108460675484607290Rat
7573752LOC102557169uncharacterized LOC102557169106273844962740315Rat
7561849LOC102555091nuclear envelope pore membrane protein POM 121-like103389166933895263Rat
7579672LOC102550782uncharacterized LOC102550782109424150994246052Rat
7562538Znf354bzinc finger protein 354B103523378335251110Rat
7563404LOC102549419uncharacterized LOC102549419106075632960769231Rat
7551922LOC102550454uncharacterized LOC102550454109416157394170717Rat
7566942Kmt5a-ps2lysine methyltransferase 5A, pseudogene 2103108663031088837Rat
7567332Ralgdsl7ral guanine nucleotide dissociation stimulator like 7104026753640269571Rat
7553451Rpl17-ps5ribosomal protein L17, pseudogene 5105729452957295230Rat
7607460LOC102555690uncharacterized LOC102555690107910421779113309Rat
7607868LOC102547954uncharacterized LOC102547954106771659967717654Rat
7568369LOC102550580uncharacterized LOC102550580108130931081317103Rat
7554930LOC102554448glyceraldehyde-3-phosphate dehydrogenase-like105123287851233686Rat
7691225LOC102548673uncharacterized LOC102548673107607484076093223Rat
7735698LOC102546674uncharacterized LOC102546674108026445580281943Rat
41054253LOC120095505U6 spliceosomal RNA106318020463180310Rat
7736477Ankfn1ankyrin-repeat and fibronectin type III domain containing 1107421414374602825Rat
7693387LOC102551705uncharacterized LOC102551705109551345495528950Rat
7694663LOC102556395uncharacterized LOC102556395107987220979881942Rat
7752480Igtpl1interferon gamma induced GTPase like 1104235964542367390Rat
7673189LOC102555366cofilin-1-like105467312254675094Rat
7676861LOC102548703probable serine/threonine-protein kinase drkD-like105690698356930190Rat
7677559LOC102546482uncharacterized LOC102546482101775083317776457Rat
7723636LOC102547955uncharacterized LOC102547955108193091281953864Rat
7724887Rab11a-ps1RAB11a, member RAS oncogene family, pseudogene 1108482351584829125Rat
7725831LOC102548512uncharacterized LOC102548512103659050736601778Rat
7736940Rpl10-ps1ribosomal protein L10, pseudogene 1103751659137518765Rat
7737472LOC102550895uncharacterized LOC102550895103792431138000504Rat
7712989LOC102548961uncharacterized LOC102548961103684575536861263Rat
7714490LOC102549660uncharacterized LOC102549660102864248628659252Rat
7738523LOC102555216uncharacterized LOC102555216105189490251922950Rat
7739209LOC102546363uncharacterized LOC102546363104416722244185891Rat
7668130LOC102546327uncharacterized LOC102546327108002225980027875Rat
7668412LOC102552371uncharacterized LOC102552371106426819464271560Rat
7698326LOC102550112uncharacterized LOC102550112109401627294038653Rat
7744446LOC102552546uncharacterized LOC102552546104017013640173126Rat
7699687Rps27-ps2ribosomal protein S27, pseudogene 2105743998557440286Rat
7701476LOC102547579uncharacterized LOC102547579105635448856384414Rat
7702025Krtap29-1keratin associated like protein 29-1108490898384910002Rat
7722794LOC102548674uncharacterized LOC102548674108306620983076178Rat
7703088LOC102548331uncharacterized LOC102548331108259315082599885Rat
7727790LOC102551165uncharacterized LOC102551165108153816281538800Rat
7748685Ifitm1-ps1interferon induced transmembrane protein 1, pseudogene 1107185252571854443Rat
7727987Mea1-ps1male-enhanced antigen 1, pseudogene 1109223205792232595Rat
7728583LOC102547722uncharacterized LOC102547722102438651124410174Rat
9129118LOC103693320uncharacterized LOC103693320103477646634790889Rat
9095316LOC10369330760S ribosomal protein L22-like 1 pseudogene102508838125095191Rat
9174727Cox11cytochrome c oxidase copper chaperone COX11107545873575465322Rat
9146354Atp5mk-ps1ATP synthase membrane subunit K, pseudogene 1105213203452140860Rat
9180709LOC103693460uncharacterized LOC103693460108854067888551970Rat
9156678Gsg1l2GSG1-like 2105246965252486333Rat
9158343LOC10369344160S ribosomal protein L27a pseudogene106255924362559753Rat
9196653Or2t43olfactory receptor family 2 subfamily T member 43104293524842936195Rat
9197903LOC103693350uncharacterized LOC103693350105180120951831435Rat
9203006Atp5mk-ps2ATP synthase membrane subunit K, pseudogene 2108620859086208921Rat
9215295Snupn-ps1snurportin 1, pseudogene 1109081068190821759Rat
9226275LOC103693408uncharacterized LOC103693408107165917271663392Rat
9229044LOC103693362uncharacterized LOC103693362105800050358011699Rat
9313918LOC103693354uncharacterized LOC103693354105382390453827703Rat
9277135LOC103693415uncharacterized LOC103693415107486760574896150Rat
9384463LOC103693449ATP synthase-coupling factor 6, mitochondrial pseudogene107862542278625920Rat
9281539Atp5mkl1ATP synthase membrane subunit K like 1104221167142212027Rat
9245120LOC103693391uncharacterized LOC103693391106103870061042736Rat
9290621LOC103693406uncharacterized LOC103693406106837370368420846Rat
9338508Tmem92-ps1transmembrane protein 92, pseudogene 1107976719279769848Rat
9339380LOC103693316activated RNA polymerase II transcriptional coactivator p15 pseudogene103047357630474470Rat
9259038Rpl12-ps8ribosomal protein L12, pseudogene 8106495466764955263Rat
9408823LOC103693305uncharacterized LOC103693305102607664326090717Rat
9447800LOC103693451transmembrane protein 92-like107973941479743041Rat
9450974LOC103693436uncharacterized LOC103693436108769411187694518Rat
9452287LOC103693333protein UXT pseudogene103966901739671564Rat
9413039Ptges3lprostaglandin E synthase 3 like108635401986361318Rat
9453438LOC10369333660S ribosomal protein L14 pseudogene103746832437469665Rat
9417566Tmsb10l2thymosin, beta 10 like 2107871166678711911Rat
9217344Map2k3osmitogen-activated protein kinase kinase 3, opposite strand104559739645607992Rat
9420753Rpl22l4ribosomal protein L22 like 4108789394887894538Rat
9685093Mir3064microRNA 3064109172580091725866Rat
9743990Selenow-ps1selenoprotein W, pseudogene 1104686871946869420Rat
10395317Hoxb5oshomeobox B5 and homeobox B6, opposite strand108125688081272747Rat
11371601Trnat-agu2transfer RNA threonine (anticodon AGU) 2105373657253736645Rat
11366402LOC108352183spindle and kinetochore-associated protein 2 pseudogene106793279067950325Rat
11358390LOC108352211uncharacterized LOC108352211107946736679474311Rat
10411933LOC106736471antisense transcript of iNOS gene106385062063851191Rat
11433460LOC108352126dual specificity protein phosphatase 26 pseudogene108234532582347303Rat
11443179Trnac-gca36transfer RNA cysteine (anticodon GCA) 36108298388482983955Rat
11462129LOC108352136uncharacterized LOC108352136108568722485689434Rat
11464772LOC10835221840S ribosomal protein S28 pseudogene103954036739540682Rat
11466692Trnan-guu10transfer RNA asparagine (anticodon GUU) 10108269643082696503Rat
11466937LOC108352202uncharacterized LOC108352202102062503820628112Rat
11468471Trnat-cgu1transfer RNA threonine (anticodon CGU) 1106466534664665417Rat
11469336LOC108352072uncharacterized LOC108352072102194260222287277Rat
11470817Krtap9-1-ps1keratin associated protein 9-1, pseudogene 1108480469884806982Rat
11471077Trnat-ugu1transfer RNA threonine (anticodon UGU) 1103322265233222724Rat
11472642LOC108352113transcription factor BTF3 homolog 4 pseudogene106766269967670029Rat
11474460Trnae-cuc5transfer RNA glutamic acid (anticodon CUC) 5104248446642484537Rat
11475289Trnap-cgg2transfer RNA proline (anticodon CGG) 2105373914653739217Rat
11435226LOC108352208uncharacterized LOC108352208106694046266956291Rat
11444070LOC108352227uncharacterized LOC108352227109393581193938379Rat
11361305Trnat-ugu2transfer RNA threonine (anticodon UGU) 2105316827653168348Rat
11444871Trnas-gcu7transfer RNA serine (anticodon GCU) 7105376376653763847Rat
11445133Trnag-ucc3transfer RNA glycine (anticodon UCC) 3105374014453740215Rat
11445698LOC108352088ferritin light chain 1 pseudogene104425750144258431Rat
11458838Trnal-uag2transfer RNA leucine (anticodon UAG) 2105382911953829200Rat
11437264LOC108352149uncharacterized LOC108352149109190004691902191Rat
11437268Trnai-aau6transfer RNA isoleucine (anticodon AAU) 6105376303553763108Rat
11437457Rpl35al3ribosomal protein L35A like 3106621006366210640Rat
11446408Trnaw-cca3transfer RNA tryptophan (anticodon CCA) 3104743153447431605Rat
11369295LOC10835207560S ribosomal protein L34 pseudogene102810055028100901Rat
11371335Trnat-agu3transfer RNA threonine (anticodon AGU) 3105376347053763543Rat
11450453Trnal-caa1transfer RNA leucine (anticodon CAA) 1104248475642484861Rat
11364143Trnav-aac5transfer RNA valine (anticodon AAC) 5103322579033225862Rat
11451344Trnan-guu9transfer RNA asparagine (anticodon GUU) 9107224297072243043Rat
11429765LOC108352174leucine-rich repeat-containing protein 37A3-like108654249386545769Rat
11372181Krtap4-8keratin associated protein 4-8108473228584732884Rat
11383644Trnac-gca35transfer RNA cysteine (anticodon GCA) 35108279438982794460Rat
11384018LOC108352132uncharacterized LOC108352132108432509184333478Rat
11405522LOC108352102chromobox protein homolog 3 pseudogene105575111555753851Rat
11412952LOC108352076uncharacterized LOC108352076102827573428366956Rat
11413531LOC108352121uncharacterized LOC108352121107817849178189087Rat
11413702Trnaq-cug6transfer RNA glutamine (anticodon CUG) 6105382948953829560Rat
11414676LOC10835342540S ribosomal protein S27-like106808969468089966Rat
11415587Trnag-gcc2transfer RNA glycine (anticodon GCC) 2105382396053824030Rat
11421503LOC10835221760S ribosomal protein L17 pseudogene103312479133125414Rat
11424155LOC108352204uncharacterized LOC108352204102073121220732795Rat
11359066Cnot6l2CCR4-NOT transcription complex, subunit 6 like 2103401895434026932Rat
11427237Trnav-aac4transfer RNA valine (anticodon AAC) 4103319402233194094Rat
11427364Trnak-cuu16transfer RNA lysine (anticodon CUU) 16103320179133201863Rat
11395747LOC108352122uncharacterized LOC108352122107844915678475943Rat
11396808LOC108352074uncharacterized LOC108352074102797451527983092Rat
11407955LOC108352086uncharacterized LOC108352086104241545842424581Rat
11385134Trnal-aag3transfer RNA leucine (anticodon AAG) 3103322615833226239Rat
11386002Trnad-guc3transfer RNA aspartic acid (anticodon GUC) 3105373971553739786Rat
11397104LOC108352070uncharacterized LOC108352070101937624019413283Rat
11397811LOC108352150uncharacterized LOC108352150109271883292732169Rat
11375109Sec61gl5SEC61 translocon subunit gamma like 5105479541354795676Rat
11376555Trnac-gca34transfer RNA cysteine (anticodon GCA) 34108279267082792741Rat
11387328LOC108352198uncharacterized LOC108352198101810235218167503Rat
11388507Trnap-ugg5transfer RNA proline (anticodon UGG) 5103322542333225494Rat
11389364LOC108352144uncharacterized LOC108352144109042062290461890Rat
11400509Trnai-aau5transfer RNA isoleucine (anticodon AAU) 5105373572753735800Rat
11411023Trnac-gca37transfer RNA cysteine (anticodon GCA) 37108298455682984627Rat
11411272C10h5orf58similar to human chromosome 5 open reading frame 58101869095818697224Rat
11411384LOC108352151uncharacterized LOC108352151109278403392784721Rat
11411642Trnaa-ugc2transfer RNA alanine (anticodon UGC) 2103320227233202343Rat
11391314Trnac-gca33transfer RNA cysteine (anticodon GCA) 33108276266482762735Rat
11402473Cdk5r1lcyclin-dependent kinase 5 regulatory subunit 1 like106548376565484289Rat
11402890LOC108352083uncharacterized LOC108352083103731910937342114Rat
11381204LOC108352141uncharacterized LOC108352141108988662589887932Rat
11381410LOC108352228uncharacterized LOC108352228109576427695778029Rat
11392345Trnaq-uug1transfer RNA glutamine (anticodon UUG) 1108079768580797756Rat
11393182LOC108348219uncharacterized LOC108348219103677128636774162Rat
11404353Trnas-aga4transfer RNA serine (anticodon AGA) 4105373620153736282Rat
11383214LOC108352124uncharacterized LOC108352124108197872381985346Rat
11393487Trnas-cga2transfer RNA serine (anticodon CGA) 2105381594853816029Rat
11519998Trnav-cac2transfer RNA valine (anticodon CAC) 2103318752533187597Rat
11505532Trnar-ucu4transfer RNA arginine (anticodon UCU) 4105382851753828603Rat
11505801Trnaw-cca4transfer RNA tryptophan (anticodon CCA) 4105374070253740773Rat
11507590LOC108352133uncharacterized LOC108352133108445089884472770Rat
11508819Trnar-ccg2transfer RNA arginine (anticodon CCG) 2109195840491958476Rat
11509389LOC108352071uncharacterized LOC108352071101941348119418566Rat
11497110Trnak-uuu4transfer RNA lysine (anticodon UUU) 4105383004653830118Rat
11510400LOC108352172spindle and kinetochore-associated protein 2 pseudogene101808982118091927Rat
11498743LOC108352146uncharacterized LOC108352146109126843491276253Rat
11512098LOC108352216uncharacterized LOC108352216102668098626695887Rat
11499743Trnat-agu4transfer RNA threonine (anticodon AGU) 4105381545753815530Rat
11475987Trnaw-cca5transfer RNA tryptophan (anticodon CCA) 5105376424553764316Rat
11482925LOC10835213960S ribosomal protein L36 pseudogene108752776687528169Rat
11485485LOC108352079uncharacterized LOC108352079102864501128668249Rat
11485617LOC108352130uncharacterized LOC108352130108374739783750366Rat
11486590LOC108352105uncharacterized LOC108352105105777415057777690Rat
11488308LOC108352222uncharacterized LOC108352222106170324561717561Rat
11492721LOC108352081heterogeneous nuclear ribonucleoprotein A3 pseudogene103323587833236925Rat
11493649Trnaw-cca2transfer RNA tryptophan (anticodon CCA) 2104609242146092492Rat
14398588Mir340-1microRNA 340-1103439356834393665Rat
21076281C10h17orf113-ps1similar to human chromosome 17 open reading frame 113, pseudogene 1108557383985576654Rat
41353991Trnat-agu17transfer RNA threonine (anticodon AGU) 17106059909960599173Rat
41378188LOC120095193uncharacterized LOC120095193109091905390920018Rat
41378413LOC120095454small nucleolar RNA SNORA17101929970519299826Rat
41110839LOC120095469small nucleolar RNA U13104255508242555186Rat
41112529LOC120095394small nucleolar RNA SNORD95103316993733170004Rat
41136370Cdk4-ps2cyclin-dependent kinase 4, pseudogene 2103805133038054594Rat
41203172Rpl30-ps12ribosomal protein L30, pseudogene 12106837771268379824Rat
41322563LOC120095092uncharacterized LOC120095092103462261534629153Rat
41356502LOC120095476U2 spliceosomal RNA108653422586534415Rat
41381218LOC120095329uncharacterized LOC120095329106175695061760551Rat
41087529LOC120095181uncharacterized LOC120095181108390560383914133Rat
41087638LOC120095089uncharacterized LOC120095089103420780234218525Rat
41138833LOC120095409small nucleolar RNA SNORA5104239359942393734Rat
41140516LOC120095427U1 spliceosomal RNA104462913344629286Rat
41249496LOC120095378U6 spliceosomal RNA109003343690033542Rat
41276998LOC120095185uncharacterized LOC120095185108770161987724858Rat
41277263LOC120095135uncharacterized LOC120095135105643903856459676Rat
41277494LOC120095325uncharacterized LOC120095325104590644445908310Rat
41278287Snord118small nucleolar RNA, C/D box 118105377481153774946Rat
41282977Msantd5l1Myb/SANT DNA binding domain containing 5 like 1103549715535499582Rat
41357294LOC120095456small nucleolar RNA SNORA17107560813475608254Rat
41381590LOC120095084uncharacterized LOC120095084103325431633263503Rat
41381824LOC120095129uncharacterized LOC120095129105494413354945385Rat
41384166Trnap-agg83transfer RNA proline (anticodon AGG) 83109145255691452636Rat
41089112LOC120095477U2 spliceosomal RNA108656210386562293Rat
41089124LOC120095164uncharacterized LOC120095164107169038771708506Rat
41113907LOC120095486U2 spliceosomal RNA103543159035431802Rat
41114130Trnat-agu11transfer RNA threonine (anticodon AGU) 11108270538282705462Rat
41140926LOC120095420small nucleolar RNA SNORA7105371208553712224Rat
41205404LOC120095284uncharacterized LOC120095284108135889981367940Rat
41205966LOC120095254uncharacterized LOC120095254102407336024087187Rat
41251551LOC120095447small nucleolar RNA SNORA17105591912355919254Rat
41252066LOC120095069uncharacterized LOC120095069102467030324672817Rat
41279133LOC120095376U6 spliceosomal RNA108382678483826885Rat
41285482Rps10-ps6ribosomal protein S10, pseudogene 6109140280291403291Rat
41325536Snora21small nucleolar RNA, H/ACA box 21108277511482775249Rat
41358241Dab1-ps1DAB adaptor protein 1, pseudogene 1106993225069934885Rat
41358298LOC120095435small nucleolar RNA SNORA48104587342045873560Rat
41115213LOC120095360U6 spliceosomal RNA106170797061708076Rat
41172258LOC120095298uncharacterized LOC120095298108860571288613782Rat
41280008LOC120095496U4 spliceosomal RNA107227127372271444Rat
41280493LOC120095440small nucleolar RNA SNORA48104551515045515292Rat
41280740LOC120095451small nucleolar RNA SNORA17106816480068164929Rat
41281133LOC120095294uncharacterized LOC120095294108708067987083716Rat
41287325Trnas-aga18transfer RNA serine (anticodon AGA) 18105557552155575593Rat
41327418LOC120095403small nucleolar RNA SNORA67104744813747448270Rat
41327488LOC120095099uncharacterized LOC120095099103847590138477636Rat
41360186Trnaa-agc91transfer RNA alanine (anticodon AGC) 91109178763191787711Rat
41360376LOC120095064uncharacterized LOC120095064101750954717513271Rat
41387346LOC120095201uncharacterized LOC120095201109410493294119320Rat
41091800Trnaa-agc92transfer RNA alanine (anticodon AGC) 92102359142323591504Rat
41092415LOC120095265uncharacterized LOC120095265106233527662340146Rat
41116338LOC120095481U2 spliceosomal RNA106807250568072695Rat
41116793LOC120095363U6 spliceosomal RNA103622744036227546Rat
41117163Rpl17-ps8ribosomal protein L17, pseudogene 8106905654669057234Rat
41173355LOC120095446small nucleolar RNA SNORA17105648235456482485Rat
41208375Ybx1-ps15Y box binding protein 1, pseudogene 15104258527142587462Rat
41327896LOC120095506U6 spliceosomal RNA103320397733204083Rat
41362314Snord95small nucleolar RNA, C/D box 95103317198333172050Rat
41388070LOC120095161uncharacterized LOC120095161106854261068547441Rat
41388596LOC120095488U2 spliceosomal RNA105963677259636857Rat
41388597LOC120095115uncharacterized LOC120095115104731848447332559Rat
41389219LOC120095125uncharacterized LOC120095125105328559053288913Rat
41093985Snord49bsmall nucleolar RNA, C/D box 49B104729694647297016Rat
41094310Snord124small nucleolar RNA, C/D box 124108367118183671284Rat
41118377LOC120095334keratin-associated protein 3-1-like108452121684521515Rat
41147093LOC120095101uncharacterized LOC120095101103893107038933247Rat
41147803LOC120095202uncharacterized LOC120095202109413667794144071Rat
41210266LOC120095489small nucleolar RNA U3107227253972272753Rat
41210406LOC120095353U6 spliceosomal RNA103096411730964223Rat
41260746LOC120095138ATP synthase subunit e, mitochondrial-like105950223859503061Rat
41390802LOC120095491small nucleolar RNA U3107228511272285326Rat
41095314LOC120095081uncharacterized LOC120095081102908747829094518Rat
41120726LOC120095203uncharacterized LOC120095203109428954194296979Rat
41176308LOC120095155uncharacterized LOC120095155106750811867610797Rat
41188203LOC120095275uncharacterized LOC120095275106689240166906045Rat
41212005LOC120095100uncharacterized LOC120095100103844807338454581Rat
41212261Eif4a1leukaryotic translation initiation factor 4A1 like105438903054402545Rat
41261840LOC120095106uncharacterized LOC120095106104129779141366702Rat
41261886LOC120095384small nucleolar RNA SNORA72102186971021869841Rat
41262638LOC120095296uncharacterized LOC120095296108815384988184195Rat
41331781LOC120095075uncharacterized LOC120095075102875381828755862Rat
41121724LOC120095173uncharacterized LOC120095173107401499674018744Rat
41188743LOC120095096uncharacterized LOC120095096103590688635912370Rat
41189455LOC120095199uncharacterized LOC120095199109386833193886407Rat
41213076LOC120095269uncharacterized LOC120095269106318112363182585Rat
41263071LOC120095102uncharacterized LOC120095102103914750039152632Rat
41366645LOC120095262ATP synthase subunit g, mitochondrial-like106009245860098807Rat
41393922Ebln1endogenous Bornavirus like nucleoprotein 1107893864578940651Rat
41098513Lyrm9l1LYR motif containing 9 like 1106372477063727454Rat
41098788LOC120095280uncharacterized LOC120095280107909155879095803Rat
41154135LOC120095391small nucleolar RNA SNORA70107213422572134346Rat
41213596Trnaa-agc51transfer RNA alanine (anticodon AGC) 51107558624175586315Rat
41265281LOC120095458small nucleolar RNA SNORA26106563109465631189Rat
41265420LOC120095247uncharacterized LOC120095247102013874520156177Rat
41344211LOC120095437small nucleolar RNA SNORA48105746106957461206Rat
41394133LOC120095116uncharacterized LOC120095116104758840047590766Rat
41395344LOC120095095uncharacterized LOC120095095103564356235647037Rat
41100182LOC120095178uncharacterized LOC120095178108035416680357816Rat
41100961LOC120095358U6 spliceosomal RNA108342161083421716Rat
41101625Cycs-ps6cytochrome c, somatic, pseudogene 6109022735690227705Rat
41123932LOC120095110uncharacterized LOC120095110104451549644532629Rat
41123949LOC120095176uncharacterized LOC120095176107776432977775450Rat
41124032LOC120095152uncharacterized LOC120095152106424612364253097Rat
41125022Rps2-ps18ribosomal protein S2, pseudogene 18106328210363283054Rat
41155963Rps2-ps16ribosomal protein S2, pseudogene 16103744923037452916Rat
41181179LOC120095070uncharacterized LOC120095070102521099925243816Rat
41216276LOC120095492small nucleolar RNA U3105541149055411704Rat
41267437LOC120095433small nucleolar RNA SNORA48105438718554387327Rat
41396154LOC120095345uncharacterized LOC120095345108011400880148484Rat
41396155LOC120095168zinc finger protein OZF-like107227465472277596Rat
41101894LOC120095392small nucleolar RNA SNORA70106346016863460267Rat
41182758LOC120095105uncharacterized LOC120095105104093548841040947Rat
41217898LOC120095073uncharacterized LOC120095073102777802927781959Rat
41268997Snord96asmall nucleolar RNA, C/D box 96A103317109333171172Rat
41346003LOC120095326thymosin beta-4-like104725993647260671Rat
41346304LOC120095245uncharacterized LOC120095245101833283518339900Rat
41070601Ankrd40clANKRD40 C-terminal like107922779179236365Rat
41103944LOC120095085uncharacterized LOC120095085103347104833479197Rat
41127486LOC120095442small nucleolar RNA SNORA48105159446451594601Rat
41159125Nop16-ps3NOP16 nucleolar protein, pseudogene 3102883471928835165Rat
41159998LOC120095297uncharacterized LOC120095297108821375888225854Rat
41160718Trnas-aga28transfer RNA serine (anticodon AGA) 28108547313785473211Rat
41184270LOC120095372U6 spliceosomal RNA106455393264554035Rat
41184374LOC120095444small nucleolar RNA SNORA17101930121219301339Rat
41195735LOC120095352U6 spliceosomal RNA106782724167827353Rat
41219772LOC120095328olfactory receptor 1500-like105852657358527511Rat
41270792LOC120095249uncharacterized LOC120095249102122099721294620Rat
41291495LOC120095432U11 spliceosomal RNA109209115592091288Rat
41348016LOC120095120uncharacterized LOC120095120104917405949180284Rat
41399483LOC120095065uncharacterized LOC120095065101920504919234280Rat
41071609LOC120095430small nucleolar RNA SNORA51109119022791190352Rat
41160913Scarna21small Cajal body-specific RNA 21105407095954071098Rat
41161246LOC120095167uncharacterized LOC120095167107188412771892284Rat
41161284LOC120095504U6 spliceosomal RNA108355069483550800Rat
41161480LOC120095487U2 spliceosomal RNA104675164646751840Rat
41186043LOC120095413small nucleolar RNA SNORA44104598895845989086Rat
41186195LOC120095396U1 spliceosomal RNA107224612572246288Rat
41186811LOC120095410small nucleolar RNA SNORA8109231467392314811Rat
41197673LOC120095381U7 small nuclear RNA108286421882864279Rat
41229016LOC120095327uncharacterized LOC120095327105645983556462713Rat
41271983LOC120095082uncharacterized LOC120095082103021597930229712Rat
41292971LOC120095191uncharacterized LOC120095191109065984090687446Rat
41293538LOC120095364U6 spliceosomal RNA107126266271262766Rat
41294032LOC120095375U6 spliceosomal RNA103858821338588317Rat
41374674Pik3r5l1phosphoinositide-3-kinase, regulatory subunit 5 like 1105313017953134007Rat
41400389LOC120095183uncharacterized LOC120095183108411931684134747Rat
41129985Dnaja1-ps3DnaJ heat shock protein family (Hsp40) member A1, pseudogene 3104480690744809907Rat
41130072LOC120095133uncharacterized LOC120095133105554279555563841Rat
41130763Gapdh-ps42Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 42107212971272130772Rat
41163241LOC120095365U6 spliceosomal RNA105959581859595922Rat
41163674LOC120095289uncharacterized LOC120095289108265989682662527Rat
41198723LOC120095179uncharacterized LOC120095179108063355380649436Rat
41230289LOC120095497U6 spliceosomal RNA105870256458702670Rat
41231368Snora50csmall nucleolar RNA, H/ACA box 50C109143557091435702Rat
41295422LOC120095175uncharacterized LOC120095175107715506277216511Rat
41351485LOC120095350U6 spliceosomal RNA106064619460646294Rat
41351506LOC120095301survival of motor neuron-related-splicing factor 30-like109187048191872151Rat
41351702LOC120095321uncharacterized LOC120095321103690149536910274Rat
41351834LOC120095368U6 spliceosomal RNA105361845253618558Rat
41375225LOC120095466U6atac minor spliceosomal RNA107391064073910741Rat
41376271LOC120095184uncharacterized LOC120095184108616721586169964Rat
41107818LOC120095498U6 spliceosomal RNA108591800185918107Rat
41108829Trnap-agg70transfer RNA proline (anticodon AGG) 70102809977528099855Rat
41131756Trnap-ggg6transfer RNA proline (anticodon GGG) 6105751059057510670Rat
41165016LOC120095252uncharacterized LOC120095252102063926520642557Rat
41296108LOC120095253uncharacterized LOC120095253102125963321273194Rat
41352320LOC120095197uncharacterized LOC120095197109266150292683626Rat
41352437LOC120095418U1 spliceosomal RNA105749985457500017Rat
41352469LOC120095323uncharacterized LOC120095323104026208740264143Rat
41353348LOC120095285uncharacterized LOC120095285108136191881367401Rat
41404206LOC120095414small nucleolar RNA SNORA44104439895344399078Rat
41404273LOC120095264uncharacterized LOC120095264106007849360085842Rat
41202203LOC120095172uncharacterized LOC120095172107384653273852817Rat
41202251LOC120095388small nucleolar RNA SNORA70103622812336228246Rat
41233495LOC120095266cytochrome c oxidase subunit 7C, mitochondrial-like106252904062529853Rat
40945377LOC120095121uncharacterized LOC120095121104990525749908359Rat
40971346Trnav-aac22transfer RNA valine (anticodon AAC) 22107095650370956575Rat
40971431LOC120095083uncharacterized LOC120095083103049211630495725Rat
40946213LOC120095361U6 spliceosomal RNA105542206955422172Rat
40947074Snord10small nucleolar RNA, C/D box 10105438629054386431Rat
40947194LOC120095429small nucleolar RNA SNORA29104727211347272242Rat
40973139LOC120095499U6 spliceosomal RNA106979847869798584Rat
41010863LOC120095090uncharacterized LOC120095090103450463234507967Rat
40973555LOC120095198uncharacterized LOC120095198109382537593830198Rat
40973775Trnav-aac25transfer RNA valine (anticodon AAC) 25109054823190548311Rat
41015986Snord42bsmall nucleolar RNA, C/D box 42B106307882563078893Rat
41016043Slirp-ps1SRA stem-loop interacting RNA binding protein, pseudogene 1104577345245776821Rat
41339704LOC120095144uncharacterized LOC120095144106146150261478891Rat
40950062LOC120095407U1 spliceosomal RNA108629847386298636Rat
40974852LOC120095377U6 spliceosomal RNA105915107859151136Rat
40975049LOC120095482U2 spliceosomal RNA108347428283474471Rat
41013754LOC120095320protein FAM162A-like103638944736391357Rat
41013792LOC120095287uncharacterized LOC120095287108182181381824811Rat
41013984LOC120095079uncharacterized LOC120095079102937281729379810Rat
40925953LOC120095062uncharacterized LOC120095062101722256217232541Rat
40954811LOC120095180uncharacterized LOC120095180108084565680859083Rat
40978598LOC120095229cytochrome b-c1 complex subunit 10-like103657209736574854Rat
40927017LOC120095189uncharacterized LOC120095189109034159690366478Rat
40980517LOC120095490small nucleolar RNA U3107226503872265252Rat
40980764LOC120095380U7 small nuclear RNA104535895345359015Rat
40999178LOC120095104ral guanine nucleotide dissociation stimulator-like104027925140281351Rat
40930232LOC120095479U2 spliceosomal RNA108658452586584715Rat
40957969LOC120095281uncharacterized LOC120095281107878300378789419Rat
40981583LOC120095439small nucleolar RNA SNORA48107787377177873910Rat
40931177LOC120095122uncharacterized LOC120095122105086476351013804Rat
40932371LOC120095142uncharacterized LOC120095142106090961660916891Rat
40983152LOC120095123uncharacterized LOC120095123105162571051701636Rat
40983522Snord7small nucleolar RNA, C/D box 7106809501568095110Rat
41003664Ldha-ps29lactate dehydrogenase A, pseudogene 29107756372577564800Rat
40960684Snord4asmall nucleolar RNA, C/D box 4A106307741963077489Rat
40984111LOC120095448small nucleolar RNA SNORA17103008879130088922Rat
41004921Trnas-aga39transfer RNA serine (anticodon AGA) 39108404409984044179Rat
41005054Snord49asmall nucleolar RNA, C/D box 49A104729748847297559Rat
40934802LOC120095480U2 spliceosomal RNA108659278386592973Rat
40936152LOC120095088uncharacterized LOC120095088103411404234116357Rat
40961371LOC120095114uncharacterized LOC120095114104594910045983918Rat
40986121Rangrf-ps1RAN guanine nucleotide release factor, pseudogene 1106615533966178353Rat
40986461LOC120095455small nucleolar RNA SNORA17102770025227700330Rat
40937826LOC120093045small nucleolar RNA SNORA19103982357539823689Rat
40937829LOC120095507U6 spliceosomal RNA104840259048402695Rat
40938096LOC120095132uncharacterized LOC120095132105545827555464324Rat
40962770LOC120095370U6 spliceosomal RNA105979642959796515Rat
40987530LOC120095286uncharacterized LOC120095286108153147481538882Rat
40988159LOC120095103uncharacterized LOC120095103103948067139488982Rat
41008485LOC120095485U2 spliceosomal RNA106056179960561883Rat
40939199LOC120095412small nucleolar RNA SNORA15104539922545399351Rat
40939305LOC120095166uncharacterized LOC120095166107192169171926768Rat
40963995Snord65small nucleolar RNA, C/D box 65104729839147298462Rat
40988783Zfp622-ps1zinc finger protein 622, pseudogene 1103288404232885277Rat
41009470Rpl9-ps21ribosomal protein L9, pseudogene 21101761446917615127Rat
41010124LOC120093097ral guanine nucleotide dissociation stimulator-like104032300740325012Rat
40965708LOC120095143uncharacterized LOC120095143106121550461216329Rat
40966030LOC120095373U6 spliceosomal RNA106459496064595066Rat
40991993Or1n2l-ps1olfactory receptor family 1 subfamily N member 2 like, pseudogene 1103538523735388191Rat
40992345LOC120095256uncharacterized LOC120095256104615568546165890Rat
40941456LOC120095450small nucleolar RNA SNORA17106254858762548718Rat
40943474LOC120095502U6 spliceosomal RNA104743497547435080Rat
40970460LOC120095356U6 spliceosomal RNA104656686946566969Rat
40994897LOC120095200uncharacterized LOC120095200109398628694022344Rat
40996120Gapdh-ps43Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 43106680369166804868Rat
40996527LOC120095462small nucleolar RNA SNORD91 family105976825759768349Rat
41046939Rpl13-ps19ribosomal protein L13, pseudogene 19105444330154452286Rat
41243156Trnaa-ugc11transfer RNA alanine (anticodon UGC) 11106130809861308179Rat
41243160LOC120095359U6 spliceosomal RNA107214793172148037Rat
41024400LOC120095419small nucleolar RNA SNORA42/SNORA80 family103640829736408432Rat
41049107LOC120095177uncharacterized LOC120095177107998469279986134Rat
41075489LOC120095423small nucleolar RNA SNORA21108926699089267117Rat
41075565Trnas-aga43transfer RNA serine (anticodon AGA) 43104228305442283127Rat
41075578Snord104small nucleolar RNA, C/D box 104109143531391435382Rat
41313827Snord42asmall nucleolar RNA, C/D box 42A106307703063077094Rat
41077213LOC120095293uncharacterized LOC120095293108557555485580104Rat
41246647LOC120095250uncharacterized LOC120095250102149522821532145Rat
41079045LOC120095494U4 spliceosomal RNA102516745825167624Rat
41247523LOC120095319uncharacterized LOC120095319103486030534860870Rat
41247591LOC120095500U6 spliceosomal RNA103048549930485605Rat
41318785LOC120095186uncharacterized LOC120095186109026236690267267Rat
41332417Rpl32-ps12ribosomal protein L32, pseudogene 12102527599025278299Rat
41135105LOC120095351U6 spliceosomal RNA109074981890749924Rat
41255405LOC120095461small nucleolar RNA SNORD91 family105976896759769057Rat
41332534LOC120095150uncharacterized LOC120095150106377186163781394Rat
41338383LOC120095445small nucleolar RNA SNORA17101966091719661046Rat
41339074Trnav-aac10transfer RNA valine (anticodon AAC) 10104628524046285312Rat
41257203LOC120095118uncharacterized LOC120095118104874285148746665Rat
41220484LOC120095503U6 spliceosomal RNA107367788973677995Rat
41221742Trnaq-cugtransfer RNA glutamine (anticodon CUG)104880306848803140Rat
41317947Snora67small nucleolar RNA, H/ACA box 67105438527654385418Rat
41033403LOC120095332uncharacterized LOC120095332107124763471250157Rat
41034231LOC120095117uncharacterized LOC120095117104853219348539710Rat
41059526LOC120095274uncharacterized LOC120095274106629879266399056Rat
41059947LOC120095331uncharacterized LOC120095331106848104268483376Rat
41224105LOC120095495U4 spliceosomal RNA104753320347533317Rat
41336825LOC120095261uncharacterized LOC120095261106002380560025404Rat
41337284LOC120095493U4 spliceosomal RNA109056480690564957Rat
41337377LOC120095453small nucleolar RNA SNORA17103306016033060278Rat
41337556LOC12009527060S ribosomal protein L12-like106494388064944475Rat
41337742LOC120095424small nucleolar RNA SNORA43106513290865133055Rat
41034882LOC120095467U6atac minor spliceosomal RNA109022333990223431Rat
41035134LOC120095119uncharacterized LOC120095119104869289748706492Rat
41035616LOC120095385U1 spliceosomal RNA107224987172250034Rat
41062475LOC120095163uncharacterized LOC120095163107165620171659142Rat
41334181LOC120095187uncharacterized LOC120095187109028417790289455Rat
41038360LOC120095322uncharacterized LOC120095322104025667040258702Rat
41063599LOC120095292uncharacterized LOC120095292108530824485320119Rat
41227580LOC120095141uncharacterized LOC120095141106083449260848996Rat
41302965LOC120095078uncharacterized LOC120095078102905821329075530Rat
41303059LOC120095244uncharacterized LOC120095244101820318618223924Rat
41303192LOC120095324uncharacterized LOC120095324104031106940313092Rat
41039235LOC120095174uncharacterized LOC120095174107447460174484980Rat
41235583LOC120095087uncharacterized LOC120095087103403766334063640Rat
41236741LOC120095342histidine triad nucleotide-binding protein 1-like105158249551582818Rat
41236916LOC120095411small nucleolar RNA SNORA4108038067580380818Rat
41304974LOC120095194uncharacterized LOC120095194109205226592054945Rat
41017670Snora80dsmall nucleolar RNA, H/ACA box 80D109218865792188789Rat
41018573LOC120095061uncharacterized LOC120095061101724705617257621Rat
41041079LOC120095158uncharacterized LOC120095158106824623968252736Rat
41042236LOC120095169uncharacterized LOC120095169107278596072790325Rat
41019588LOC120095484U2 spliceosomal RNA108587276985872905Rat
41019890LOC120095318uncharacterized LOC120095318102868818128689960Rat
41020299LOC120095369U6 spliceosomal RNA107249647272496575Rat
41068944Hmgn1-ps5high mobility group nucleosome binding domain 1, pseudogene 5106158043761594037Rat
41238789LOC120095283uncharacterized LOC120095283108121716181229312Rat
41238863Phb1-ps7prohibitin 1, pseudogene 7102465927924670076Rat
41307510LOC120095366U6 spliceosomal RNA106459891864599020Rat
41020996Trnat-agu28transfer RNA threonine (anticodon AGU) 28105478231054782382Rat
41021983LOC120095371U6 spliceosomal RNA105397692453977028Rat
41241036LOC120095415small nucleolar RNA SNORA44108556625885566369Rat
41241343Fbxo5-ps1F-box protein 5, pseudogene 1106018104060182414Rat
41310478Trnaa-cgctransfer RNA alanine (anticodon CGC)106516743865167510Rat
41023768LOC120095478U2 spliceosomal RNA108658078086580970Rat
728895Trhdethyrotropin-releasing hormone degrading enzyme74994327150350613Rat

Nucleotide Sequences
GenBank Nucleotide CH473948 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000240 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
634329Pia15Pristane induced arthritis QTL 153.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10124158324Rat
2293680Bss40Bone structure and strength QTL 405.660.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)10135225947Rat
634327Hc4Hypercalciuria QTL 42.4urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)10138328221Rat
7411611Foco17Food consumption QTL 1718.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)10142315980Rat
70223Bp57Blood pressure QTL 575arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)10180676123Rat
10401803Kidm50Kidney mass QTL 50kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1041834445418344Rat
631554Bp133Blood pressure QTL 1330.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1074336463851208Rat
1576304Schws7Schwannoma susceptibility QTL 70.0115nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)10476552719816042Rat
631828Alc5Alcohol consumption QTL 52.4consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)10514402717245662Rat
737820Alc9Alcohol consumption QTL 92.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)10514402719233348Rat
2313064Bmd71Bone mineral density QTL 710.90.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)10538701450387014Rat
2313066Bss63Bone structure and strength QTL 631.40.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)10538701450387014Rat
2313081Bss64Bone structure and strength QTL 641.30.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)10538701450387014Rat
2313095Bss62Bone structure and strength QTL 621.50.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)10538701450387014Rat
2313104Bss61Bone structure and strength QTL 610.90.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)10538701450387014Rat
2298544Neuinf9Neuroinflammation QTL 94.6nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)10580199062146030Rat
8662860Vetf10Vascular elastic tissue fragility QTL 10artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)10615418273453136Rat
61427Cia16Collagen induced arthritis QTL 163.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10635789696121100Rat
1578761Stresp21Stress response QTL 213.3thymus mass (VT:0004954)thymus wet weight (CMO:0000855)10637574651375746Rat
2303118Mamtr7Mammary tumor resistance QTL 70.003mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)109658275104670812Rat
9590310Scort19Serum corticosterone level QTL 196.30.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101147401056474010Rat
9590268Scort13Serum corticosterone level QTL 133.260.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101147401056474010Rat
9589136Insul27Insulin level QTL 2710.460.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)101147401056474010Rat
2301967Cm73Cardiac mass QTL 734.55heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)101448701189062041Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014487011104060283Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014487011107057807Rat
1354587Kidm21Kidney mass QTL 213.3kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)101502851360430477Rat
631564Apr3Acute phase response QTL 33.9blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)101527595560275955Rat
6893350Bw99Body weight QTL 990.870.16body mass (VT:0001259)body weight (CMO:0000012)11590666560906665Rat
6893352Bw100Body weight QTL 1000.330.6body mass (VT:0001259)body weight (CMO:0000012)11590666560906665Rat
737823Alc12Alcohol consumption QTL 124.5consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)101724551319388279Rat
631532Cm50Cardiac mass QTL 506.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)101790711351786432Rat
1598852Anxrr19Anxiety related response QTL 195.07body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)101816784163167841Rat
2313055Bw96Body weight QTL 963.60.0001body mass (VT:0001259)body weight (CMO:0000012)101960648364606483Rat
2313087Bmd80Bone mineral density QTL 803.20.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)101960648364606483Rat
1554317Bmd4Bone mineral density QTL 49.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)101981604299406971Rat
1581497Esta1Estrogen-induced thymic atrophy QTL 1thymus mass (VT:0004954)thymus wet weight (CMO:0000855)102132980561345413Rat
724556Pur2Proteinuria QTL 25.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)102242750090627625Rat
631531Iresp2Immunoglobin response QTL26.3blood immunoglobulin E amount (VT:0002492)serum immunoglobulin E level (CMO:0002101)102291826836400810Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
70224Eae3Experimental allergic encephalomyelitis QTL 34.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)102652195761345413Rat
1298069Bp168Blood pressure QTL 1685.5blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)102652195798003205Rat
631542Bp82Blood pressure QTL 826.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)102652195798952741Rat
2300171Bmd58Bone mineral density QTL 584.90.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)102694462871944628Rat
10402859Bp381Blood pressure QTL 3810.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102760646872606468Rat
2292441Bp308Blood pressure QTL 308arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102760646872606468Rat
2298480Eau7Experimental allergic uveoretinitis QTL 70.0049uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)102795762634490668Rat
724527Bp148Blood pressure QTL 1480.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102845313673453136Rat
1600371Mcs21Mammary carcinoma susceptibility QTL 213mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)102887565052200160Rat
1331762Rf40Renal function QTL 403.873kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)102929950464155584Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)1029299504107211142Rat
631557Bp136Blood pressure QTL 1360.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)103063205375632053Rat
1576311Pia26Pristane induced arthritis QTL 26joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103122402675632053Rat
1578779Tcas10Tongue tumor susceptibility QTL 103.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)103129743976297439Rat
1576319Cia29Collagen induced arthritis QTL 29joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103397392178973921Rat
61332Eau3Experimental allergic uveoretinitis QTL 30.004uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)103449055945579777Rat
1354614Hpcl1Hepatic cholesterol level QTL 13.3liver cholesterol amount (VT:0010498)liver cholesterol level (CMO:0001597)103539226751793994Rat
1358897Stresp6Stress response QTL 64.170.022blood norepinephrine amount (VT:0005663)plasma norepinephrine level (CMO:0001010)103539226764155584Rat
61441Btemp1Thermal response to stress QTL 14body temperature trait (VT:0005535)core body temperature (CMO:0001036)103539245763642539Rat
2317042Aia20Adjuvant induced arthritis QTL 203.38joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)103756507982565079Rat
2317043Aia7Adjuvant induced arthritis QTL 73.82joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)103756507982565079Rat
1576308Schws1Schwannoma susceptibility QTL 10.0041nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)1040035094102359817Rat
631269Cia22Collagen induced arthritis QTL 228.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
631270Cia23Collagen induced arthritis QTL 233.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
631552Vetf2Vascular elastic tissue fragility QTL 24.50.0002aorta elastic tissue integrity trait (VT:0010556)artery internal elastic lamina non-tumorous lesion count (CMO:0001913)104114263386142633Rat
61463Bp12Blood pressure QTL 126.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)104133325886333258Rat
8552805Bw145Body weight QTL 1452.2body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)104194452678307017Rat
1298078Stresp5Stress response QTL 52.990.00025blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1042045676104670812Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)14232313287323132Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)14232313287323132Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)14232313287323132Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)14232313287323132Rat
70198BpQTLcluster9Blood pressure QTL cluster 92.94arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)104232313287323132Rat
6893342Cm78Cardiac mass QTL 780.10.88heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)104287676679813922Rat
9589030Epfw9Epididymal fat weight QTL 919.240.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)104444169989441699Rat
7411614Foco18Food consumption QTL 180.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)104444169989441699Rat
8694173Bw149Body weight QTL 1494.380.001body mass (VT:0001259)body weight gain (CMO:0000420)104444169989441699Rat
2300218Hpcl2Hepatic cholesterol level QTL 2liver cholesterol amount (VT:0010498)liver cholesterol level (CMO:0001597)104502965095600334Rat
631547Bp87Blood pressure QTL 874.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)104736947092369470Rat
2293705Bmd25Bone mineral density QTL 257.10.0001femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)104944455181709989Rat
7207811Bmd90Bone mineral density QTL 905.2femur size trait (VT:1000369)femoral neck cross-sectional area (CMO:0001697)104944455181709989Rat
2293652Bmd22Bone mineral density QTL 224.90.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)104944455181709989Rat
2293669Bmd33Bone mineral density QTL 334.50.0001femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)104944455181709989Rat
2293679Bmd30Bone mineral density QTL 303.50.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)104944455181709989Rat
1549846Scl47Serum cholesterol level QTL 473.6blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)105057470795574707Rat
70364Bp72Blood pressure QTL 72arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)105112110096121100Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1051770177107211142Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1051770177107211142Rat
1359017Hrtrt21Heart rate QTL 212.4heart pumping trait (VT:2000009)heart rate (CMO:0000002)105177294096772940Rat
631530Tls3T-lymphoma susceptibility QTL 300.0001thymus integrity trait (VT:0010555)percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)105177461295600334Rat
631535Cm51Cardiac mass QTL 513heart mass (VT:0007028)calculated heart weight (CMO:0000073)105178628291669536Rat
1578762Toxo1Toxoplasma gondii resistance QTL 1brain integrity trait (VT:0010579)percentage of study population displaying Toxoplasma gondii brain cysts at a point in time (CMO:0002028)105220003059378278Rat
1354585Eae18aExperimental allergic encephalomyelitis QTL 18a7.50.0004nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)105379738558445852Rat
2306787Ean3Experimental allergic neuritis QTL 33.1nervous system integrity trait (VT:0010566)body weight loss (CMO:0001399)105379738566979128Rat
70171Cari1Carrageenan-induced inflammation QTL 14.90.0005hypodermis integrity trait (VT:0010550)inflammatory exudate volume (CMO:0001429)1053797385107211142Rat
70164Bw21Body weight QTL 214.360.00005body mass (VT:0001259)body weight (CMO:0000012)105379749498952626Rat
631652Bp106Blood pressure QTL 106arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)105432493354332939Rat
1354608Cm33Cardiac mass QTL 332.8heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)105480929299809292Rat
2298495Eae23Experimental allergic encephalomyelitis QTL 2316.93nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis duration (CMO:0001424)105527369660677262Rat
2312662Slep8Serum leptin concentration QTL 80.05blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1057134272102134272Rat
2312668Scl65Serum cholesterol level QTL 650.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1057134272102134272Rat
2312672Insul15Insulin level QTL 150.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1057134272102134272Rat
1549831Bss6Bone structure and strength QTL 64lumbar vertebra strength trait (VT:0010574)vertebra ultimate force (CMO:0001678)1057576521102576521Rat
2293698Bss43Bone structure and strength QTL 435.330.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1059209888104209888Rat
1331839Eae18bExperimental allergic encephalomyelitis QTL 18b5.80.03nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)106124830367785171Rat
70363Bp71Blood pressure QTL 710.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)106134527681714865Rat
2306970Anxrr22Anxiety related response QTL 225.95fear/anxiety-related behavior trait (VT:1000241)number of periods of voluntary immobility (CMO:0001045)106134527698211570Rat
6893336Cm75Cardiac mass QTL 750.10.87heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)106134527699703528Rat
1558643Cm44Cardiac mass QTL 444.80.0000368heart mass (VT:0007028)heart wet weight (CMO:0000069)106134527699703528Rat
631526Bp76Blood pressure QTL 760.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)106134541366743655Rat
61402Niddm3Non-insulin dependent diabetes mellitus QTL 34.58blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)106134541382564856Rat
2313103Bss80Bone structure and strength QTL 8020.0001tibia strength trait (VT:1000284)tibia midshaft endosteal cross-sectional area (CMO:0001716)1062057807107057807Rat
2313105Bss79Bone structure and strength QTL 791.80.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)1062057807107057807Rat
61449Ciaa2CIA Autoantibody QTL 27.1blood autoantibody amount (VT:0003725)calculated serum anti-type 2 collagen antibody titer (CMO:0001279)1063221094107211142Rat
2298481Eau9Experimental allergic uveoretinitis QTL 90.0169uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)106592723382565079Rat
11565453Kidm58Kidney mass QTL 580.002kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)106631944767750281Rat
12903252Cm113Cardiac mass QTL 1130.047heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)106631944767750281Rat
12903266Cm114Cardiac mass QTL 1140.02heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)106631944767750281Rat
12903269Am15Aortic mass QTL 150.042aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)106631944767750281Rat
2301405Cm69Cardiac mass QTL 690.031heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)106631944767750281Rat
12880370Cm105Cardiac mass QTL 1050.008heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)106631944768164786Rat
12880371Cm106Cardiac mass QTL 1060.007heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)106631944768164786Rat
12880372Am12Aortic mass QTL 120.003aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)106631944768164786Rat
12880375Kidm66Kidney mass QTL 660.009kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)106631944768164786Rat
1357344Bp249Blood pressure QTL 2490.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)106674365598003205Rat
631565Hcuc4Hepatic copper content QTL 44.15liver copper amount (VT:0003065)liver copper weight to liver dry weight ratio (CMO:0001512)106694181373452992Rat
8657410Bp374Blood pressure QTL 374heart left ventricle size trait (VT:0002753)heart left ventricle end-diastolic diameter (CMO:0000982)106697895567750281Rat
2317029Aia19Adjuvant induced arthritis QTL 192.98joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)1066978955107211142Rat
2317039Aia6Adjuvant induced arthritis QTL 64.31joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)1066978955107211142Rat
1579917Bp282Blood pressure QTL 2820.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)106740031668164786Rat
2289985Bp305Blood pressure QTL 305arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)106750210873579767Rat
2292440Bp312Blood pressure QTL 312arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)106775004968164786Rat
10450498Bp384Blood pressure QTL 3840.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1067750049107211142Rat
1642290Bp299Blood pressure QTL 299arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)106823013469282520Rat
1642980Bp300Blood pressure QTL 300arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1068383129107211142Rat
61396Bp9Blood pressure QTL 94.80.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1068420376107211142Rat
2300172Bmd57Bone mineral density QTL 579.80.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1069738412107211142Rat
2293646Bss25Bone structure and strength QTL 2510.960.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1069738412107211142Rat
2293663Bss33Bone structure and strength QTL 339.340.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1069738412107211142Rat
6893366Bw106Body weight QTL 1060.30.47body mass (VT:0001259)body weight (CMO:0000012)1070199100107211142Rat
10450500Bp385Blood pressure QTL 3850.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107111521771966743Rat
2292439Bp309Blood pressure QTL 309arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107111521771966743Rat
12903245Cm110Cardiac mass QTL 1100.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)107111521772606468Rat
12903246Cm111Cardiac mass QTL 1110.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)107111521772606468Rat
12903247Cm112Cardiac mass QTL 1120.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)107111521772606468Rat
12903248Am14Aortic mass QTL 140.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)107111521772606468Rat
12903249Kidm68Kidney mass QTL 680.02kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)107111521772606468Rat
12902615Bw185Body weight QTL 1850.01body mass (VT:0001259)body weight (CMO:0000012)107111521772606468Rat
1579918Bp279Blood pressure QTL 2790.01arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107111521772606468Rat
70193Mcs7Mammary carcinoma susceptibility QTL 72.38mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1072224939107211142Rat
2298548Neuinf7Neuroinflammation QTL 73.4nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)1072224939107211142Rat
2306793Ean5Experimental allergic neuritis QTL 54.7nervous system integrity trait (VT:0010566)IFNG-secreting splenocyte count (CMO:0002122)107255241693995749Rat
2289982Bp303Blood pressure QTL 303arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)107345299275632053Rat
724555Bp150Blood pressure QTL 1500.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107345299278210622Rat
12880053Cm104Cardiac mass QTL 1040.009heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)107345299283463334Rat
1358188Ept9Estrogen-induced pituitary tumorigenesis QTL 93.9pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)107345313696120911Rat
2292617Ept18Estrogen-induced pituitary tumorigenesis QTL 183.9pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)107345313696120911Rat
2289983Bp304Blood pressure QTL 304arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)107357954174119158Rat
12880050Am10Aortic mass QTL 100.016aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)107437208484007272Rat
1579919Bp281Blood pressure QTL 2810.01arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107437208494965338Rat
631537Oia4Oil induced arthritis QTL 4joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)107563188787055282Rat
2325836Bp346Blood pressure QTL 3460.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107624608584007272Rat
10450495Bp383Blood pressure QTL 3830.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107624608594965338Rat
2292438Bp311Blood pressure QTL 311arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1076246085107211142Rat
1302404Cia27Collagen induced arthritis QTL 272.60.0045joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)1076452683107211142Rat
4889492Pancm2Pancreatic morphology QTL 23.2pancreatic beta cell morphology trait (VT:0005217)ratio of insulin-positive cell area to total area of splenic region of pancreas (CMO:0001814)1076748906107211142Rat
724516Uae17Urinary albumin excretion QTL 173.6urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)107821062285220348Rat
1300107Rf18Renal function QTL 183.41urine output (VT:0003620)timed urine volume (CMO:0000260)107877551698279596Rat
1358915Stresp7Stress response QTL 73.52blood norepinephrine amount (VT:0005663)plasma norepinephrine level (CMO:0001010)107889965587307728Rat
634354Rends3Renal damage susceptibility QTL 30.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)107981378985160854Rat
631555Bp134Blood pressure QTL 1340.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)108051528791230079Rat
6893357Bw102Body weight QTL 1020.50.36body mass (VT:0001259)body weight (CMO:0000012)1080515287101325465Rat
2303589Bw87Body weight QTL 872body mass (VT:0001259)body weight (CMO:0000012)1081285008107211142Rat
4889948Bss91Bone structure and strength QTL 914tibia area (VT:1000281)tibia midshaft total cross-sectional area (CMO:0001715)108256485692369470Rat
2317754Glom25Glomerulus QTL 253.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)1082685200107211142Rat
12880055Am11Aortic mass QTL 110.004aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)108400727295933025Rat
2301398Kidm38Kidney mass QTL 380.002kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)108400727295933025Rat
2306792Ean4Experimental allergic neuritis QTL 44nervous system integrity trait (VT:0010566)IFNG-secreting splenocyte count (CMO:0002122)108402232193995963Rat
1600367Mcs15Mammary carcinoma susceptibility QTL 154.5mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1085565469103884409Rat
631538Oia5Oil induced arthritis QTL 5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1087055121107211142Rat
2313856Bp342Blood pressure QTL 3424.40.0001life span trait (VT:0005372)age at time of death (CMO:0001193)108730761796121100Rat
61363Oia3Oil induced arthritis QTL 30.001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1087307617107211142Rat
634320Niddm49Non-insulin dependent diabetes mellitus QTL 494.41blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1088539139107211142Rat
1558652Bw57Body weight QTL 574.20.0008body mass (VT:0001259)body weight (CMO:0000012)108932701790930437Rat
12880395Cm109Cardiac mass QTL 1090.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)1090404397107211142Rat
12880396Am13Aortic mass QTL 130.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)1090404397107211142Rat
12880398Kidm67Kidney mass QTL 670.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1090404397107211142Rat
12880384Cm107Cardiac mass QTL 1070.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)90404397107211142Rat
12880385Cm108Cardiac mass QTL 1080.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)90404397107211142Rat
1579915Bp280Blood pressure QTL 2800.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1090404397107211142Rat
1300137Bp186Blood pressure QTL 1863.57arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)1090627439107057807Rat
724530Bp149Blood pressure QTL 1490.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1090627439107211142Rat
61436Cia5Collagen induced arthritis QTL 54.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1091228102104060283Rat
70168Eae12Experimental allergic encephalomyelitis QTL 120.0009nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)1092238497101012337Rat
1354641Bvd2Brain ventricular dilatation QTL 26.360.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)1093223816107057807Rat
631558Bp137Blood pressure QTL 1370.013arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)109472486096836268Rat
10450493Bp382Blood pressure QTL 3820.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1094759759107211142Rat
2292436Bp310Blood pressure QTL 310arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1094759759107211142Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)7924703115097879Rat
9590102Sffal5Serum free fatty acids level QTL 58.620.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)7532901950329019Rat
10755440Coatc10Coat color QTL 100coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7749649952496499Rat
10059592Kidm45Kidney mass QTL 453.950.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)7757398552573985Rat
2298547Neuinf5Neuroinflammation QTL 53.7nervous system integrity trait (VT:0010566)spinal cord Cd74 protein level (CMO:0002131)7946224658265113Rat
1643004Pain2Pain QTL 21mechanical nociception trait (VT:0002734)self mutilation severity score (CMO:0002145)7946224698011544Rat
1578652Bmd15Bone mineral density QTL 155.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)7986646760460686Rat
738033Anxrr6Anxiety related response QTL 64.1exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)71557388960573889Rat
2317059Aia15Adjuvant induced arthritis QTL 152.46joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)71700459862004598Rat
10755451Coatc11Coat color QTL 110coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)71794435762944357Rat
1354639Spl5Serum phospholipid level QTL 53.9blood LDL phospholipid amount (VT:0010505)blood low density lipoprotein phospholipid level (CMO:0001568)71965431752888450Rat
1300132Bp182Blood pressure QTL 1823.49arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)71965431784928080Rat
7411569Bw137Body weight QTL 1370.001body mass (VT:0001259)body weight gain (CMO:0000420)72192119566921195Rat
1641885Alcrsp9Alcohol response QTL 9alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)72409960669099606Rat
1549840Bss5Bone structure and strength QTL 59.8femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)72475184169751841Rat
70190Mcs6Mammary carcinoma susceptibility QTL 62.29mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)72673740163902784Rat
1300138Hrtrt9Heart rate QTL 94.72heart pumping trait (VT:2000009)heart rate (CMO:0000002)72940968353612950Rat
10402855Bp379Blood pressure QTL 3790.21arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)72940968374409683Rat
1300127Srn1Serum renin concentration QTL 13.87blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)72940968384928080Rat
10755453Coatc12Coat color QTL 120coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)73111283276112832Rat
7411605Foco14Food consumption QTL 1424.10.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)73429328279293282Rat
631534Lnnr1Liver neoplastic nodule remodeling QTL 13.850.001liver integrity trait (VT:0010547)liver remodeling tumorous lesion number to liver total tumorous lesion number ratio (CMO:0001705)73429328279293282Rat
631513Scl7Serum cholesterol level QTL 74.1blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)73796056982960569Rat
2303629Vencon3Ventilatory control QTL 37.25respiration trait (VT:0001943)respiration rate (CMO:0000289)74110969256793354Rat
61357Bp38Blood pressure QTL 381.60.052arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)741333674119109060Rat
634326Hc3Hypercalciuria QTL 32.1urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)74278731487787314Rat
10053722Scort27Serum corticosterone level QTL 272.410.0083blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)74322875088228750Rat
1358361Sradr5Stress Responsive Adrenal Weight QTL 55.55adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)743747012108555253Rat
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)743747012135012528Rat
1300149Cm6Cardiac mass QTL 64.09heart mass (VT:0007028)heart left ventricle weight to body weight ratio (CMO:0000530)743747099102228765Rat
631504Cm27Cardiac mass QTL 273.45heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)744421311118198041Rat
61428Scl3Serum cholesterol level QTL 33.2blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)74486753389867533Rat
738030Anxrr8Anxiety related response QTL 84.1exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)74659007091590070Rat
10059605Kidm47Kidney mass QTL 472.910.05kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)74725178365728867Rat
2293696Bmd32Bone mineral density QTL 325.10.0001femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)74765143992651439Rat
2293707Bss32Bone structure and strength QTL 327.640.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)74765143992651439Rat
2300178Bmd54Bone mineral density QTL 545.30.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)74765143992651439Rat
2293644Bmd29Bone mineral density QTL 295.40.0001femur size trait (VT:1000369)femoral neck cross-sectional area (CMO:0001697)74765143992651439Rat
2293667Bss42Bone structure and strength QTL 427.250.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)74765143992651439Rat
2293678Bss24Bone structure and strength QTL 246.710.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)74765143992651439Rat
2293685Bmd21Bone mineral density QTL 214.20.0003femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)74765143992651439Rat


Additional Information

Database Acc Id Source(s)
UniSTS 518219 UniSTS