D18Chm16 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D18Chm16

Symbol: D18Chm16
Previously known as:
RGD ID: 1578828
Expected Size: 170 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21648,381,457 - 48,381,490 (+)MAPPERmRatBN7.2
mRatBN7.2188,164,972 - 8,165,134 (+)MAPPERmRatBN7.2
Rnor_6.0188,539,876 - 8,540,045NCBIRnor6.0
Rnor_5.0188,390,823 - 8,391,028UniSTSRnor5.0
RGSC_v3.4188,437,145 - 8,437,314UniSTSRGSC3.4
Celera188,325,166 - 8,325,281UniSTS
Cytogenetic Map18 RGD


Annotation


References - curated
# Reference Title Reference Citation
1. A loss of genome buffering capacity of Dahl salt-sensitive model to modulate blood pressure as a cause of hypertension. Charron S, etal., Hum Mol Genet. 2005 Dec 15;14(24):3877-84. Epub 2005 Nov 8.
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCTCCCATTGATTCCAGATG
Reverse Primer TTTGGTGCTCCCAGGAATTA
 
Template
AGTTATTTGGTTTCTTGGAGGTTAACTTGTTGAGTTTTTTTTATTATTATTCTTTGTTATTTTA
TTTATTTACATATAAAATGTTGTTCCCCTTCAGAATGTCCCCTCCAAAAATCCCCATCATCCTC
CCTCCCCTTTGCACCTAAGAAGGTGCTCCCAGACCAACCTGCCCACTACTACCTAACCCCTCTT
GCATCCTCATACACTGGGGCCTCAAAACTCCACAGGCCCAAGGGCCTCCCCTCCCATTGATTCC
AGATGAGGCAGTCGGCAGTCATCTGGTATATATATATATATATATATATATATATATATATATA
TATATATATATATATATATATATATATATATATATATATATATCTGGAGACATACTCTTTGGTT
GGTAGTTTAATTCCTGGGAGCACCAAAGGGTCCATTTAGTTAGTATTGTTCTTCCTATGAGGTT
ACAATCCCCTTTAGCTCCTTCAGTGTTTCCCCTAATTCTTCCACTGGGGCCCCTGGGTTCAGTC
TGATGGTTGTCTGGGAGTATCTGCATCTGTATTGGTCAGGTGCTGGTCAGAACCTCTCAGGGAA
GATCCATACCAGGC

Region

Nucleotide Sequences
GenBank Nucleotide AC110682 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
61405Niddm6Non-insulin dependent diabetes mellitus QTL 63.660.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)16422760948972724Rat
61338Bp23Blood pressure QTL 234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760949227609Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
70215Niddm29Non-insulin dependent diabetes mellitus QTL 293.54blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)161900443575226532Rat
2302057Pia29Pristane induced arthritis QTL 293.60.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)162173597566735975Rat
8694453Bw172Body weight QTL 1728.330.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)162432551369325513Rat
6903294Stl30Serum triglyceride level QTL 302.60.0013blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)162515279370152793Rat
1298529Arunc1Aerobic running capacity QTL 14exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)163195152060148445Rat
1578768Stresp22Stress response QTL 222.8thymus mass (VT:0004954)thymus wet weight (CMO:0000855)163528887080288870Rat
2293690Bss45Bone structure and strength QTL 455.130.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)163775215682752156Rat
2300163Bmd64Bone mineral density QTL 645.30.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)163775215682752156Rat
7205510Activ5Activity QTL 53.780.00028locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)164239634584729064Rat
631833Sach2Saccharin preference QTL 240.01consumption behavior trait (VT:0002069)calculated saccharin drink intake rate (CMO:0001613)164302484250166018Rat
8552968Pigfal19Plasma insulin-like growth factor 1 level QTL 1911.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)18125758124Rat
9590248Scort10Serum corticosterone level QTL 1019.710.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)18125758124Rat
2312598Bp340Blood pressure QTL 3400.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)18130558703Rat
2300180Bmd67Bone mineral density QTL 674.80.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)18134291613Rat
2293661Bss50Bone structure and strength QTL 504.640.0003lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)18134291613Rat
61388Bp2Blood pressure QTL 23.23arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)18135374722Rat
9589153Insul31Insulin level QTL 317.150.05blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)18142547119Rat
1641910Colcr3Colorectal carcinoma resistance QTL 35.020.000007intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor surface area measurement (CMO:0002078)18224947722066430Rat
1641910Colcr3Colorectal carcinoma resistance QTL 35.020.000007intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor number (CMO:0002076)18224947722066430Rat
2299160Iddm35Insulin dependent diabetes mellitus QTL 352.79blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)18420794160377792Rat
2312568Glom21Glomerulus QTL 2120.005kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)18518585840503530Rat
11565454Kidm59Kidney mass QTL 590.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)18679125112205285Rat
12904714Cm131Cardiac mass QTL 1310.002heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)18679125112205285Rat
12904715Cm132Cardiac mass QTL 1320.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)18679125112205285Rat
12904716Am21Aortic mass QTL 210.005aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)18679125112205285Rat
2301409Cm70Cardiac mass QTL 700.001heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)18679125112205285Rat


Additional Information

Database Acc Id Source(s)
UniSTS 518050 UniSTS